View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16688_low_73 (Length: 251)
Name: NF16688_low_73
Description: NF16688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16688_low_73 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 9 - 251
Target Start/End: Complemental strand, 35814592 - 35814359
Alignment:
| Q |
9 |
cgaagaatatcaagaacatggttgaagttacagtgtgatagtggaactagtggattttgactcttgagatattgattaaaggtgttccaatctctacgtt |
108 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35814592 |
cgaagaaaatcaagaacatggttgaagttacagtgtgatagtggaactagtggattttgactcttgagatattgattaaaggtgttccaatctctacgtt |
35814493 |
T |
|
| Q |
109 |
tttgagattcatacctgcttagtggttgttgttgctgatgatcatgatgatgattggatttggaagaagatgcgtgaagagaagagttttcgatttggga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35814492 |
tttgagattcatacctgcttagtggttgttgttgctga---------tgatgattggatttggaagaagatgggtgaagagaagagttttcgatttggga |
35814402 |
T |
|
| Q |
209 |
agaggaagaagacatgttttgtggttgacagggtaaggtgaaa |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35814401 |
agaggaagaagacatgttttgtggttgacagggtaaggtgaaa |
35814359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University