View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16688_low_76 (Length: 248)
Name: NF16688_low_76
Description: NF16688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16688_low_76 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 18 - 225
Target Start/End: Original strand, 11587052 - 11587255
Alignment:
| Q |
18 |
acacattatgggtgatcttaaaaggactcaaacacacatttgaggggattatatataaatcattaacactgaccactttcttaaattaagagttaattac |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||||||||||||| |||| ||||||||||||||||||||| | |
|
|
| T |
11587052 |
acacattatgggtgatcttaaagggactcaaacacacatttgagggtattatatgtaaatcattaacattgacaactttcttaaattaagagtta----c |
11587147 |
T |
|
| Q |
118 |
atctaggaacatgattgtattattaaattgcaattaaataccaaccatataattattggtatttatcctagacaaaaagtggtgaaaccacaattcaaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11587148 |
atctaggaacatgattgtattattaaattgcaattaaataccaatcatataattattggtatttatcctagacaaaaagtggtgaaaccacaattcaaaa |
11587247 |
T |
|
| Q |
218 |
aatggaat |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
11587248 |
aatggaat |
11587255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University