View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16688_low_78 (Length: 246)
Name: NF16688_low_78
Description: NF16688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16688_low_78 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 94; Significance: 5e-46; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 18 - 111
Target Start/End: Complemental strand, 32635152 - 32635059
Alignment:
| Q |
18 |
gataacactcctccttcctctattccatcacattgcatcgtttcctttcatttttatatagtttgtggtagttatcgatctgtgttttgtgaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32635152 |
gataacactcctccttcctctattccatcacattgcatcgtttcctttcatttttatatagtttgtggtagttatcgatctgtgttttgtgaca |
32635059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 125 - 181
Target Start/End: Complemental strand, 32634948 - 32634892
Alignment:
| Q |
125 |
gtgtatttctttgactgtcggctccgtgcgtcttgcatgggtggggttttaataata |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32634948 |
gtgtatttctttgactgtcggctccgtgcgtcttgcatgggtggggttttaataata |
32634892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 32634707 - 32634654
Alignment:
| Q |
173 |
ttaataatatatgttgattcaaacaa-aaaattgttatgaaccttcacttatta |
225 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
32634707 |
ttaataatatttgttgattcaaacaaaaaaattgttatgaatcttcacttatta |
32634654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University