View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16688_low_82 (Length: 238)
Name: NF16688_low_82
Description: NF16688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16688_low_82 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 29481062 - 29481291
Alignment:
| Q |
1 |
tttatataagataaaagagatagagtaattatacccgtcgaaatgccacccggtcaagttagctacttgagatagagcagttttccatttaagcactttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29481062 |
tttatataagataaaagagatagagtaattatacccgtcgaaatgccacccgggcaagttagctacttgagatagagcggttttccatttaagcactttc |
29481161 |
T |
 |
| Q |
101 |
tccttgttttcatggaacctctcctcgtgctttacgaatgcagcttcaaaaggtccactttggtgtcgcacatgagaaggtttaatattgtaaaaaaccg |
200 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |||||| |
|
|
| T |
29481162 |
tccctgttttcatggaacctctcctcgtgctttacgaatgcagcttcaaaaggtccactttggtgtcgcacatgagaagcttcaatattgtaataaaccg |
29481261 |
T |
 |
| Q |
201 |
gaaaaataaatcgaaggttgtctctctgct |
230 |
Q |
| |
|
||| |||||||||||||||||| ||||||| |
|
|
| T |
29481262 |
gaacaataaatcgaaggttgtcactctgct |
29481291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 211
Target Start/End: Complemental strand, 29617869 - 29617812
Alignment:
| Q |
154 |
tccactttggtgtcgcacatgagaaggtttaatattgtaaaaaaccggaaaaataaat |
211 |
Q |
| |
|
||||||||||| ||||||||||||||| | || |||||||||||||||| ||||||| |
|
|
| T |
29617869 |
tccactttggtttcgcacatgagaaggatctatgttgtaaaaaaccggaataataaat |
29617812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University