View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16691_high_2 (Length: 297)
Name: NF16691_high_2
Description: NF16691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16691_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 1 - 287
Target Start/End: Original strand, 42559273 - 42559556
Alignment:
| Q |
1 |
gttttttgcaagaatgttggaagtgacattgatgttgtgagactcgattttgatgaaaggagtgtgagatgtaagaaaggagaaagtagtgtctgtggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42559273 |
gttttttgcaagaatgttggaagtgacattgatgttgtgagactcgattttgatgaaaggagtgtgagatgtaagaaaggagaaagtagtgtctgtggat |
42559372 |
T |
 |
| Q |
101 |
gatgatgatgatgtgtggagttttgatctgaggataggatgggaattttgtagtttgtggagtgaggtttgaaaacgggaaatatcaatgggttttgtga |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42559373 |
g---atgatgatgtgtggagttttgatctgaggataggatgggaattttgtagtttgtggagtgaggtttgaaaacgggaaatatcaatgggttttgtga |
42559469 |
T |
 |
| Q |
201 |
tgagtagtgataaaactgcaatgccggtgccaccacgaatggctttgcaccagctacattctgtgccaccaacattacgaccctttg |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42559470 |
tgagtagtgataaaactgcaatgccggtgccaccacgaatggctttgcaccagctacattctgtgccaccaacattacgaccttttg |
42559556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 128 - 164
Target Start/End: Complemental strand, 25993977 - 25993941
Alignment:
| Q |
128 |
ctgaggataggatgggaattttgtagtttgtggagtg |
164 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
25993977 |
ctgaggataggatgggaattttggagtttgtggagtg |
25993941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University