View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16691_high_6 (Length: 251)
Name: NF16691_high_6
Description: NF16691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16691_high_6 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 13 - 251
Target Start/End: Original strand, 41734724 - 41734961
Alignment:
| Q |
13 |
aaaattaagatttgagcttgtcgaaatttcaagaaactcaacctacactttgccggtagaatctgagtttgccgggagcttactaaaattttagataatt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41734724 |
aaaattaagatttgagcttgtcgaaatttcaagaaactcaacctacactttgccggtagaatctgagtttgccaggagcttactaaaattttagataatt |
41734823 |
T |
 |
| Q |
113 |
aattgtcatccagccagcttgtgtaaaaatgtgtttagannnnnnnnnnggttatgattaagggtaatttgttaagtttaggaaacttgtgaaaactgag |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41734824 |
aattgtcatccagccagcttgtgtaaaaatgtgtttaga-tttttttttggttacgattaagggtaatttgttaagtttaggaaacttgtgaaaactgag |
41734922 |
T |
 |
| Q |
213 |
ttgtatgaggtacattattcctaagtttctcatggaaaa |
251 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41734923 |
ttgcatgaggtacattattcctaagtttctcatggaaaa |
41734961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University