View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16691_low_5 (Length: 291)
Name: NF16691_low_5
Description: NF16691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16691_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 168 - 273
Target Start/End: Complemental strand, 41735178 - 41735068
Alignment:
| Q |
168 |
atcaataacaaacgaggattataatagagatgaacatgttatg-----aatggacctttcgaacatgctagcgatataatgagtgtgtaattttttgttg |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41735178 |
atcaataacaaacgaggattataatagagatgaacatgttatgttatgaatggacctttcggacatgctagcgatataatgagtgtgtaattttttgttg |
41735079 |
T |
 |
| Q |
263 |
aagggagtgta |
273 |
Q |
| |
|
|||| |||||| |
|
|
| T |
41735078 |
aaggcagtgta |
41735068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 18 - 103
Target Start/End: Complemental strand, 41735339 - 41735244
Alignment:
| Q |
18 |
cttatgtctatgcaataataacatacacatgcttccatcaatcg----------taattggttaggctagtacattgattggtatgaaattgctta |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41735339 |
cttatgtctatgcaataataacatacacatgcttccatcactcgtaatatggcataattggttaggctagtacattgattggtatgaaattgctta |
41735244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University