View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16692_high_11 (Length: 258)
Name: NF16692_high_11
Description: NF16692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16692_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 138; Significance: 3e-72; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 80 - 241
Target Start/End: Complemental strand, 26311810 - 26311649
Alignment:
| Q |
80 |
ggtatgggggatataactcgacaactagccactgtccagtaaatggtcccccatttttagaccaccatgggtggcaacgcctccatagttgggtcaaggg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
26311810 |
ggtatgggggatataactcgacaagtagccactgtccagtaaatggtcccccatttttagaccaccacgggtggcaacgcctccatagttgggtgaaggg |
26311711 |
T |
 |
| Q |
180 |
ggaactggcctttggctaagaaccggttgccacgagttgactaggtcgcattaagatacgac |
241 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26311710 |
ggaactgtcctttggctaagaactggttgccacaagttgactaggtcgcattaagatacgac |
26311649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 45 - 87
Target Start/End: Complemental strand, 26312344 - 26312302
Alignment:
| Q |
45 |
aatcaatatgttacactagccctatttaagggattggtatggg |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26312344 |
aatcaatatgttacactagccctatttaagggattggtatggg |
26312302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 188 - 240
Target Start/End: Complemental strand, 26341090 - 26341038
Alignment:
| Q |
188 |
cctttggctaagaaccggttgccacgagttgactaggtcgcattaagatacga |
240 |
Q |
| |
|
|||||||||| |||||| ||||||| ||| |||||| | |||||||||||||| |
|
|
| T |
26341090 |
cctttggctatgaaccgattgccacaagtagactagcttgcattaagatacga |
26341038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University