View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16692_high_5 (Length: 343)
Name: NF16692_high_5
Description: NF16692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16692_high_5 |
 | |
|
| [»] scaffold0651 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 14 - 280
Target Start/End: Complemental strand, 31314272 - 31314008
Alignment:
| Q |
14 |
aggtagggtagttacctaaagttagttatatggtatgggcctgccctgccctgccctctatttctacctatatcctctggtggaaggtataataatcaag |
113 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31314272 |
aggtagggtagttgcctaaagttagttatatggtatgg-cctgccccgccctgccctctatttctacctatatcctctggtggaaggtataataatcaag |
31314174 |
T |
|
| Q |
114 |
aaatgattaaagttgattagggagaaatctctatccccatccccaaataatgaaacaaacaagcttagattt-agtcaattgtatatccctttctttcat |
212 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| | |
|
|
| T |
31314173 |
aaatgatgaaa--tgattagggagaaatctctatccccatcaccaaataatgaaacaaacaagcttagattttagtcaattgcatatccctttctttctt |
31314076 |
T |
|
| Q |
213 |
atcttccgcttccaactccccacatttatttcacttaaataattagatatcagtctagcagattctcc |
280 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31314075 |
atcttccgcttccagctccccacatttatttcacttaaataattagatatcagtctagcagattctcc |
31314008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 183 - 280
Target Start/End: Original strand, 31315054 - 31315151
Alignment:
| Q |
183 |
tttagtcaattgtatatccctttctttcatatcttccgcttccaactccccacatttatttcacttaaataattagatatcagtctagcagattctcc |
280 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
31315054 |
tttagtcaattgcatatccctttctttcatatcttccgcttccaactccccacatttatttcacttaaataattagatatcagtatatcagattctcc |
31315151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0651 (Bit Score: 86; Significance: 5e-41; HSPs: 1)
Name: scaffold0651
Description:
Target: scaffold0651; HSP #1
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 183 - 280
Target Start/End: Complemental strand, 8643 - 8546
Alignment:
| Q |
183 |
tttagtcaattgtatatccctttctttcatatcttccgcttccaactccccacatttatttcacttaaataattagatatcagtctagcagattctcc |
280 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
8643 |
tttagtcaattgcatatccctttctttcatatcttccgcttccaactccccacatttatttcacttaaataattagatatcagtatatcagattctcc |
8546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University