View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16692_low_13 (Length: 258)

Name: NF16692_low_13
Description: NF16692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16692_low_13
NF16692_low_13
[»] chr5 (3 HSPs)
chr5 (80-241)||(26311649-26311810)
chr5 (45-87)||(26312302-26312344)
chr5 (188-240)||(26341038-26341090)


Alignment Details
Target: chr5 (Bit Score: 138; Significance: 3e-72; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 80 - 241
Target Start/End: Complemental strand, 26311810 - 26311649
Alignment:
80 ggtatgggggatataactcgacaactagccactgtccagtaaatggtcccccatttttagaccaccatgggtggcaacgcctccatagttgggtcaaggg 179  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||    
26311810 ggtatgggggatataactcgacaagtagccactgtccagtaaatggtcccccatttttagaccaccacgggtggcaacgcctccatagttgggtgaaggg 26311711  T
180 ggaactggcctttggctaagaaccggttgccacgagttgactaggtcgcattaagatacgac 241  Q
    ||||||| ||||||||||||||| ||||||||| ||||||||||||||||||||||||||||    
26311710 ggaactgtcctttggctaagaactggttgccacaagttgactaggtcgcattaagatacgac 26311649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 45 - 87
Target Start/End: Complemental strand, 26312344 - 26312302
Alignment:
45 aatcaatatgttacactagccctatttaagggattggtatggg 87  Q
    |||||||||||||||||||||||||||||||||||||||||||    
26312344 aatcaatatgttacactagccctatttaagggattggtatggg 26312302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 188 - 240
Target Start/End: Complemental strand, 26341090 - 26341038
Alignment:
188 cctttggctaagaaccggttgccacgagttgactaggtcgcattaagatacga 240  Q
    |||||||||| |||||| ||||||| ||| |||||| | ||||||||||||||    
26341090 cctttggctatgaaccgattgccacaagtagactagcttgcattaagatacga 26341038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University