View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16692_low_6 (Length: 336)
Name: NF16692_low_6
Description: NF16692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16692_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 1 - 320
Target Start/End: Complemental strand, 43339813 - 43339494
Alignment:
| Q |
1 |
cacagacaacattgtcggtgaacatctcttattacttcccttctccgcaattccactctagctggcagcctgctccaaatctgcgaagctgctgccacaa |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43339813 |
cacacacaacattgtcggtgaacatctcttattacttcccttctccgcaattccactctagttggcagcctgctccaaatctgcgaagctgctgccacaa |
43339714 |
T |
|
| Q |
101 |
taatcttcatcatattcagcatcacggaacaaatttgacagcaccaaatagaannnnnnnncaccaagaaccctgctccttcgtcgggcagccagcagaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43339713 |
taatcttcatcatattcagcatcacggaacaaatttgacagcaccaaatagaattttttttcaccaagaaccctgctccttcgtcgggcagccagcagaa |
43339614 |
T |
|
| Q |
201 |
ggtatcagaaacagatggtcgcggctgcacctgcagaatttcctactgcaaaacagatggtccggttgcaaatttttggaccaattccatctccaaatcc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43339613 |
ggtatcagaaacagatggtcgcggctgcacctgcagaatttcctactgcaaaacagatggtccggttgcaaatttttggaccaattccatctccaaatcc |
43339514 |
T |
|
| Q |
301 |
acacattatctcaccaacat |
320 |
Q |
| |
|
||| |||||||||||||||| |
|
|
| T |
43339513 |
acatattatctcaccaacat |
43339494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University