View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16693_high_32 (Length: 204)
Name: NF16693_high_32
Description: NF16693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16693_high_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 1e-70; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 24 - 190
Target Start/End: Complemental strand, 21552142 - 21551976
Alignment:
| Q |
24 |
tgcagccaatgttgggttcgcacagaagttcgactgcatatttaccagctgaggttccatgtatgttgctgaaagtaacatcactcacttccactgcact |
123 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||| || |
|
|
| T |
21552142 |
tgcagccgatgttgggttcacacagaagttcgactgcatatttaccagttgaggttccatgtatgttgctgaaagtaacatcacttacttccactgcgct |
21552043 |
T |
|
| Q |
124 |
atcttgaactggaagataattctggttaatatacacagggttcttgacttcaacaagtgtgatatct |
190 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
21552042 |
atcttgaactggaatataattctggttaatatacacagggttctcgacttcaacaagtgtaatatct |
21551976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 49 - 127
Target Start/End: Complemental strand, 38097773 - 38097695
Alignment:
| Q |
49 |
aagttcgactgcatatttaccagctgaggttccatgtatgttgctgaaagtaacatcactcacttccactgcactatct |
127 |
Q |
| |
|
|||||||| |||||||| |||| |||||||||| ||||||||||| ||||||||||||| | ||| || ||||||||| |
|
|
| T |
38097773 |
aagttcgattgcatattcaccaactgaggttcctcgtatgttgctgtaagtaacatcactaatttcaacggcactatct |
38097695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 118
Target Start/End: Original strand, 19056262 - 19056306
Alignment:
| Q |
74 |
gaggttccatgtatgttgctgaaagtaacatcactcacttccact |
118 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
19056262 |
gaggttccatgtatgttgaggaaagtaacatcactcactttcact |
19056306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University