View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16693_low_19 (Length: 289)
Name: NF16693_low_19
Description: NF16693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16693_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 19 - 274
Target Start/End: Complemental strand, 35753932 - 35753664
Alignment:
| Q |
19 |
agaaaatgtgtggcttgtaaactatcaaattcctgaaaaaagagcatgattttgtgctgtttgaatgtttgacat----------ttcggtttcttttag |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | |
|
|
| T |
35753932 |
agaaaatgtgtggcttgtaaactatcaaattcctgaaaaaagagcatgattttgtgctgtttgaatgtttgacatacttcgttgattcggtttctttttg |
35753833 |
T |
|
| Q |
109 |
tgcatttgtcgggattcagtcacttgactatttatcttagaactgtctatgctttataagtactacgtaagcaatatctctaggcgacgtgggactaaac |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35753832 |
tgcatttgtcgggattcagtcacttgactatttatcttagaactgtctatgctttataagtactacgtaagcaatatctctaggcgatgtgggactaaac |
35753733 |
T |
|
| Q |
209 |
caactcggcgacc---tgctttattacggaaatgaaagcagacaatgtggtcaagtagtggaccacaag |
274 |
Q |
| |
|
|||| ||| |||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35753732 |
caacgcggtgaccctgtgctttattacggcaatgaaagcagacaatgtggtcaagtagtggaccacaag |
35753664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 25 - 93
Target Start/End: Complemental strand, 35753471 - 35753403
Alignment:
| Q |
25 |
tgtgtggcttgtaaactatcaaattcctgaaaaaagagcatgattttgtgctgtttgaatgtttgacat |
93 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||| | |||| || |||||||||| ||||||||||||||| |
|
|
| T |
35753471 |
tgtgtggcttgtaatctatctaattcctgaaatatgagcgtggttttgtgctgcttgaatgtttgacat |
35753403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University