View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16693_low_20 (Length: 288)
Name: NF16693_low_20
Description: NF16693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16693_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 15 - 277
Target Start/End: Original strand, 28435748 - 28436010
Alignment:
| Q |
15 |
acatccccatagcagtgactcctatgggtgcttctggtgagaatctcaattgcagcagcgcgggttgccctgcaaatataaatactatgtgtccgacaga |
114 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28435748 |
acatccccatagcagtgactcctatgagtgcttctggtgagaatctcaattgcagcagcgcgggttgccctgcaaatataaatactatgtgtccgacaga |
28435847 |
T |
|
| Q |
115 |
gcttaaggtgatggaaaatgaggatgtggtcgcttgtcaaggagcttgctctacagataatttggaaaatttttgttgtcttaagagtaacttttcaact |
214 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28435848 |
gcttaaggtgatggaaaatgaggatgtagtcgcttgtcaaggagcttgctctacagataatttggaaaatttttgttgtcttaagagtaacttttcaaca |
28435947 |
T |
|
| Q |
215 |
agtgaaacttgtgatccaagttcttatgctctcacattcaagacagcatgtcctcatgcctat |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28435948 |
agtgaaacttgtgatccaagttcttatgctctcacattcaagacagcatgtcctcatgcctat |
28436010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University