View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16693_low_22 (Length: 283)
Name: NF16693_low_22
Description: NF16693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16693_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 10 - 206
Target Start/End: Original strand, 9000920 - 9001094
Alignment:
| Q |
10 |
aaatgaatagccatggaccatgtaattaatcatgcaatctccctagttttacaaagaatatgagtagccataacaaacaaaaaactaacacatcattccc |
109 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9000920 |
aaatgaatagcaatggaccatgtaat----catgcaatctccctagttttacaaagaatatgagtagccataacaaacaaaaaactaacacat------- |
9001008 |
T |
|
| Q |
110 |
tgcttctacatctctcccacacacaaaaccaaaaccaattgttcaaaatttaaacacgggtcgcagaggaaaacaattcacaatcaaatacttctaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9001009 |
-----------ctctcccacacacaaaaccaaaaccaattgttcaaaatttaaacacgggtagcagaggaaaacaattcacaatcaaatacttctaa |
9001094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 202 - 267
Target Start/End: Original strand, 9001887 - 9001952
Alignment:
| Q |
202 |
tctaaccaaagcaaatgatgctcctcaaattgatcgttcattgtatttcacccttagggattcaaa |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9001887 |
tctaaccaaagcaaatgatgctcctcaaattgatcgttcattgtatttcacccttagggattcaaa |
9001952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University