View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16693_low_23 (Length: 277)
Name: NF16693_low_23
Description: NF16693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16693_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 259
Target Start/End: Original strand, 35628300 - 35628558
Alignment:
| Q |
1 |
actatgaaagagtgagacaattaatccaagtccctagtatagtttatgtannnnnnnnnnnnnnnnnnnnnnnnataggccgattattagtaatttattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
35628300 |
actatgaaagagtgagacaattaatccaagtccctagtatagtttatgtagtttttgtttttcttgtttgttttataggcagattattagtaatttattt |
35628399 |
T |
 |
| Q |
101 |
gttagggtgaagaagattggttagcctcagagatcaaatcttgaacttgttagttaaaaaatacttttttgatgtactaacacataccacttgaataatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35628400 |
gttagggtgaagaagattggttagcctcagagatcaaatcttgaacttgttagttaaaaaatacttttttgatgtactaacacataccacttgaataatc |
35628499 |
T |
 |
| Q |
201 |
ctttggacattcattgttttactttataattctaagtttggcaatctttttcttctttc |
259 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35628500 |
ctttggatattcattgttttactttataattctaagtttggcaatctttttcttctttc |
35628558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University