View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16693_low_24 (Length: 270)
Name: NF16693_low_24
Description: NF16693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16693_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 33656949 - 33656721
Alignment:
| Q |
1 |
gtatggatgggatctcataatcatactggtgtctcggcctttatttcgttcatcattgctcttaattaaacttccttgtggtaaacatggaggaatttca |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33656949 |
gtatggacgggatctcataatcatactggtgtctctgcctttatttcgttcatcattgctcttaattaaacttccttgtggtaaacgtggaggaatttca |
33656850 |
T |
|
| Q |
101 |
cacatctattttccgctattttttcccacatccgtccaattttacacggaagctttactaatagacatgacaaatatcttaatgtgagagtaaattagca |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33656849 |
cacatctattttccgctatttattcccacatccgtccaattttacacggaagttttactaatagacatgacaaatatcttaatgtgagagtaaattagca |
33656750 |
T |
|
| Q |
201 |
aatagtatctttttaggtcacaatattat |
229 |
Q |
| |
|
|||||||||||| |||||||||||||||| |
|
|
| T |
33656749 |
aatagtatctttgtaggtcacaatattat |
33656721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University