View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16693_low_25 (Length: 260)
Name: NF16693_low_25
Description: NF16693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16693_low_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 13 - 242
Target Start/End: Original strand, 9488861 - 9489090
Alignment:
| Q |
13 |
agcagagaaatctaaggagacaaaagcttgggtaaaccaactcaatgaccagcttcagaaccgcgagttcgaagaagccaaaaaatagaacatttgatct |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9488861 |
agcagagaaatctaaggagacaaaagcttgggtaaaccaacccaatgaccagcttcagaaccgcgagttcgaagaagccaaaaaatagaacatttgatct |
9488960 |
T |
 |
| Q |
113 |
aggagcattcattttttctacaatgtgtttctttcaccttcaggacaaagtgaagcttttgcgatgagtattgttagttagttcaatagacaatgtattt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9488961 |
aggagcattcattttttctacaatgtgtttctttcaccttcaggacaaagtgaagcttttgcgatgagtattgttagtaagttcaatagacaatgtattt |
9489060 |
T |
 |
| Q |
213 |
gtgtgtttatgaatcgttttaaatagaata |
242 |
Q |
| |
|
||||||||| |||||||||||||||||||| |
|
|
| T |
9489061 |
gtgtgtttaggaatcgttttaaatagaata |
9489090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University