View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16693_low_29 (Length: 251)
Name: NF16693_low_29
Description: NF16693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16693_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 16 - 237
Target Start/End: Complemental strand, 35948334 - 35948111
Alignment:
| Q |
16 |
atggaaaaactagaca--gataaattaaatacaggcatatgactccgtcaagaaaagaaacacattattacttgatagactttaagattacgtacgtaga |
113 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35948334 |
atggaaaaactagacaaagataaattaaatacaggcatatgactcagtcaagaaaagaaacacattattacttgatagactttaagtttacgtacgtaga |
35948235 |
T |
 |
| Q |
114 |
acaacgtcgtacgtgtgacgtcacttatctttctcaaagtctataaatttgaacaccaagcttctactatgaaaaacacacaaaagagaaaatggagagc |
213 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
35948234 |
ataacgtcgtacgtgtgacgtcacttatctttctcaaagtctataaatttgaacaccaagcttctactatgaaacacgcacaaaagagaaaatggagagc |
35948135 |
T |
 |
| Q |
214 |
acacagagaactttgagcttgttg |
237 |
Q |
| |
|
|||||||||| |||||||||||| |
|
|
| T |
35948134 |
acacagagaaagttgagcttgttg |
35948111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 173 - 237
Target Start/End: Complemental strand, 35953713 - 35953649
Alignment:
| Q |
173 |
gcttctactatgaaaaacacacaaaagagaaaatggagagcacacagagaactttgagcttgttg |
237 |
Q |
| |
|
|||||||| |||||| ||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35953713 |
gcttctacaatgaaacacacaaaaaagagaaaatggtgagcacacagagaactttgagcttgttg |
35953649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University