View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16693_low_30 (Length: 250)
Name: NF16693_low_30
Description: NF16693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16693_low_30 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 12 - 250
Target Start/End: Original strand, 176128 - 176366
Alignment:
| Q |
12 |
atgaagatttattcttggtatcagtataacaacttgataaaatgagttacaacccctaaatagatttaaatactacctacacaatcagtaggtataaatg |
111 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
176128 |
atgaagatttattcttggtattagtataacaacttgataaaatgagttacaacccctaaatagatttaaatactacctacacaatgagtaggtataaatg |
176227 |
T |
|
| Q |
112 |
gaggaaaaacccaaaaagagaacatagtaaagcaagtatttttagagagagatacaaccttatctttgtagagttgtttgagttgagcaacaccttggat |
211 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
176228 |
gaggaaaaacccaaaaacagaacatagtaaagaaagtatttttagagagagatacaaccttatctttgtagagttgtttgagttgagcaacaccttggat |
176327 |
T |
|
| Q |
212 |
acctttctgaacgagttttctgaaatttctgggacccac |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
176328 |
acctttctgaacgagttttctgaaatttctgggacccac |
176366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University