View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16694_low_5 (Length: 297)
Name: NF16694_low_5
Description: NF16694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16694_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 5e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 77 - 280
Target Start/End: Complemental strand, 32618309 - 32618105
Alignment:
| Q |
77 |
caaactttctaatccccatcttcttctcttcaatttattttgtaggttttcaaactttctaatctctatcttctcctcttcaattgtattttgcagaaaa |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32618309 |
caaactttctaatccccatcttcttctcttcaatttattttgtaggttttcaaactttctaatctctatcttctcctcttcaattgtattttgcagaaaa |
32618210 |
T |
 |
| Q |
177 |
cttgaagtgctgt-nnnnnnnncaatcatgaacaacttttcaaatatacaagttcatttgatgtttaaagtgtctaaaatttactcttttctttatctga |
275 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32618209 |
cttgaagtgctgtaaaaaaaaacaatcatgaacaacttttcaaatatacaagttcatttgatgtttaaagtgtctaaaatttactcttttctttatctga |
32618110 |
T |
 |
| Q |
276 |
catgt |
280 |
Q |
| |
|
||||| |
|
|
| T |
32618109 |
catgt |
32618105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 203 - 280
Target Start/End: Original strand, 3593649 - 3593726
Alignment:
| Q |
203 |
atgaacaacttttcaaatatacaagttcatttgatgtttaaagtgtctaaaatttactcttttctttatctgacatgt |
280 |
Q |
| |
|
||||||||||||||| || |||||||||| |||||||||| |||||||||||||| ||||||||||||| | |||||| |
|
|
| T |
3593649 |
atgaacaacttttcagatctacaagttcacttgatgtttatagtgtctaaaatttgctcttttctttatttaacatgt |
3593726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University