View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16695_low_12 (Length: 311)
Name: NF16695_low_12
Description: NF16695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16695_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 18 - 176
Target Start/End: Complemental strand, 43588844 - 43588687
Alignment:
| Q |
18 |
caatcattttgaggagggaataacttatcatcaactgttctttcttataagaatacacaacagctaaaatgaataataattacgactagctaaaatgtca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| | |
|
|
| T |
43588844 |
caatcattttgaggagggaataacttatcatcaactgttctttcttataaaaatacacaacagctaaaatgaataacaattacgactagctaaaatgtaa |
43588745 |
T |
|
| Q |
118 |
tgaaataataaatgaagaacctctattgccagtaaaatttgttttcagttgtccaaccc |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43588744 |
tgaaataataaatgaagaacctctattgccagtaaaatttg-tttcagttgtccaaccc |
43588687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 241 - 311
Target Start/End: Complemental strand, 43588622 - 43588552
Alignment:
| Q |
241 |
gtttactatccaatgaatatgcttctttgattatgcaaccaaccaaatgcagctgaaaaaactagtttacc |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43588622 |
gtttactatccaatgaatatgcttctttgattatgcaaccaaccaaatgcagctgaaaaaactagtttacc |
43588552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University