View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16696_high_15 (Length: 226)
Name: NF16696_high_15
Description: NF16696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16696_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 2 - 220
Target Start/End: Original strand, 444833 - 445051
Alignment:
| Q |
2 |
ttcagcctaaatattatgattttgtatcggcatctctcagcatcaagactgcggctttatcattccttgcaggtggttgaaaaggattgtgatgattcag |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
444833 |
ttcagcctaaatattatgattttgtatcggcatctctcagcatcaagactgcggctttatcattcgttgcaggtggttgaaaaggattgtgatgattcag |
444932 |
T |
 |
| Q |
102 |
acagcgatgatgagttgcctcatttgaaggtgtgattaaatcatagtatttgaatcgatgttgnnnnnnngttaagattagtggctttcatattaagttg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
444933 |
acagcgatgatgagttgcctcatttgaaggtgtgattaaatcatagtatttgaatcgatgttgtttttttgttaagattagtggctttcatattaagttg |
445032 |
T |
 |
| Q |
202 |
tctgtaattgatgatgtcc |
220 |
Q |
| |
|
||||||||||||| ||||| |
|
|
| T |
445033 |
tctgtaattgatggtgtcc |
445051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University