View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16696_high_5 (Length: 443)
Name: NF16696_high_5
Description: NF16696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16696_high_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 16 - 409
Target Start/End: Complemental strand, 3078440 - 3078041
Alignment:
| Q |
16 |
acaaagcaatatggttcgaatagagaattttgctttggaaggaggtcctaataaagaaatatatggttcaaatgtttgtggtttgttggaaggaggaatc |
115 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||||||||||||| |||||| |||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3078440 |
acaaagcaatatggttcgaatagagaaatatgctttggaaggaggttctaatagagaaatat--ggttcgaatgtttgtggtttgttggaaggaggaatc |
3078343 |
T |
 |
| Q |
116 |
gcgagttgcccatcgaattcctcaagatggtggaaggatttagttagtattgaaggaagagatgggtcgtattggtttaatgaagaggttgctagaaagg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3078342 |
gcgagttgcccatcgaattcctcaagatggtggaaggatttagttagtattgaaggaagagatgggtcgtattggtttaataaagaggttgctagaaagg |
3078243 |
T |
 |
| Q |
216 |
tgagaaatggggctcataccaagttttgggatgccaagtggagagggggtg------ttcgagtgaaatatcctagactttttgcaatgtctaaccaaaa |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
3078242 |
tgagaaatggggctcataccaagttttgggatgcgaagtggagagggggtgttccttttcgagtgaaatattctagaccttttgcaatgtctaaccaaaa |
3078143 |
T |
 |
| Q |
310 |
ggaggcaacggtggcggatattggggtgtttaccggctcggtgatggattggcg--ttgtgtggaggcggcgtttctttatttgggaggaacaattgttg |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3078142 |
ggaggcaacggtggcggatattggggtgtttaccggctcggtgatggattggcgttttgtgtggaggcggcgtttctttatttgggaggaacaattgttg |
3078043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 290 - 338
Target Start/End: Complemental strand, 44514169 - 44514121
Alignment:
| Q |
290 |
tttgcaatgtctaaccaaaaggaggcaacggtggcggatattggggtgt |
338 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||| ||| |||||| |
|
|
| T |
44514169 |
tttgctatgtctaaccaaaaggaggcaacggtagcggagatttgggtgt |
44514121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 275 - 327
Target Start/End: Complemental strand, 14249118 - 14249066
Alignment:
| Q |
275 |
aaatatcctagactttttgcaatgtctaaccaaaaggaggcaacggtggcgga |
327 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||| || |||| |||||||| |
|
|
| T |
14249118 |
aaatatccgagactttttgcaatttctaaccaaaaagatgcaaaagtggcgga |
14249066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 275 - 323
Target Start/End: Original strand, 19471430 - 19471478
Alignment:
| Q |
275 |
aaatatcctagactttttgcaatgtctaaccaaaaggaggcaacggtgg |
323 |
Q |
| |
|
|||||||||||||||||| |||| || | |||||||||||| ||||||| |
|
|
| T |
19471430 |
aaatatcctagacttttttcaatttcaacccaaaaggaggctacggtgg |
19471478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University