View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16696_high_9 (Length: 343)
Name: NF16696_high_9
Description: NF16696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16696_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 18 - 337
Target Start/End: Complemental strand, 35205718 - 35205399
Alignment:
| Q |
18 |
acttaactctggtgttgttccggctattgttaaagttttaggttcttcggataaaggttatgttgttaatgattgtttagcggttttggtagcattggcg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35205718 |
acttaactctggtgttgttccggctattgttaaagttttaggttcttcggataaaggttatgttgttaatgattgtttagcggttttggtagcattggcg |
35205619 |
T |
 |
| Q |
118 |
gagaatgtggatggtgctcgtgctgtattagaatgctcgggtttgtcattggttattgggattttgcaatctgcaaattcgagtgcggagaaggagtact |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35205618 |
gagaatgtggatggtgctcgtgctgtattagaatgctcgggtttgtcattggttattgggattttgcaatctgcaaattcgcgtgcggagaaggagtact |
35205519 |
T |
 |
| Q |
218 |
gtgtttccattttggtttcactatgtgttaatgttggtggagaggttgttagtgttttggcgaagcatgcttcggggattatgcctttgctttatgcaaa |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35205518 |
gtgtttccattttggtttcactatgtgttaatgttggtggagaggttgttagtgttttggcgaagcatgcttcggggattatgcctttgctttatgcaaa |
35205419 |
T |
 |
| Q |
318 |
tcttacctatgctactcctc |
337 |
Q |
| |
|
||||||| ||| |||||||| |
|
|
| T |
35205418 |
tcttaccgatggtactcctc |
35205399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University