View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16697_high_23 (Length: 301)

Name: NF16697_high_23
Description: NF16697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16697_high_23
NF16697_high_23
[»] chr3 (1 HSPs)
chr3 (14-283)||(48478993-48479262)


Alignment Details
Target: chr3 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 14 - 283
Target Start/End: Original strand, 48478993 - 48479262
Alignment:
14 agaccaaagactctccagttctgcttgacgtcaccggaatgatgtgcggcgggtgcgtctcccgagtcaaaaccattctctcctccgacgatcgagttga 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48478993 agaccaaagactctccagttctgcttgacgtcaccggaatgatgtgcggcgggtgcgtctcccgagtcaaaaccattctctcctccgacgatcgagttga 48479092  T
114 ctctgtagttgtcaacatgttgactgaaaccgccgctgttaagcttaaaaagctcgaagaggaatctaccagcgttgcggatggacttgctcggagattg 213  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48479093 ctctgtagttgtcaacatgttgactgaaaccgctgctgttaagcttaaaaagctcgaagaggaatctaccagcgttgcggatggacttgctcggagattg 48479192  T
214 acgggatgcgggtttccgacgaagaggagagaatcgggtttaggagtttcggagaatgtgaggaagtgga 283  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48479193 acgggatgcgggtttccgacgaagaggagagaatcgggtttaggagtttcggagaatgtgaggaagtgga 48479262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University