View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16697_high_31 (Length: 253)
Name: NF16697_high_31
Description: NF16697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16697_high_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 46 - 234
Target Start/End: Complemental strand, 37630993 - 37630795
Alignment:
| Q |
46 |
attcgagttgatttaattaaggttttaatgtgtgattaacgaaagatgattagatcaataaaatgaagaattagaatta----------taatgaaaacc |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37630993 |
attcgagttgatttaattaaggttttaatgtgtgattaacgaaaggtgattagatcaataaaatgaagaattagaattagagagaattataatgaaaacc |
37630894 |
T |
 |
| Q |
136 |
ttgaacggagccgatttccttctcgaccttggcatgcatttcacgaagagcagcggcttcttcttccatttccttcaagcggcgcctcatctcatcgag |
234 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37630893 |
ttgaacggagccaatttccttctcgaccttggcatgcatttcacgaagagcagcggcttcttcttccatttccttcaagcggcgcctcatctcgtcgag |
37630795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 32
Target Start/End: Complemental strand, 37631023 - 37630992
Alignment:
| Q |
1 |
attatatagtgaggaagatgattgcatgcaat |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37631023 |
attatatagtgaggaagatgattgcatgcaat |
37630992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University