View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16697_low_33 (Length: 251)
Name: NF16697_low_33
Description: NF16697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16697_low_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 11 - 243
Target Start/End: Complemental strand, 13413382 - 13413150
Alignment:
| Q |
11 |
gataatactactaggaaggtgggggatggatgtctacattgttttggaaggacgatggcttgatggatccattttaaaagcttgttttagtagacttttt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13413382 |
gataatactactaggaaggtgggggatggatgtctacattgttttggaaggacggtggcttgatggatccattttaaaagcttgttttagtagacttttt |
13413283 |
T |
 |
| Q |
111 |
gagctgacggacaataaatcaaccaatgttgcaaagatgcactttttacgttgagaggttaatggtgaggcgtatggggctgtttgtgtgggaggatgat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13413282 |
gagctgacggacaataaatcaaccaatgttgcagagatgcactttttaggttgagaggttaatggtgaggcgtatgaggctgtttgtgtgggaggatgat |
13413183 |
T |
 |
| Q |
211 |
ttgctgagggagtgtatgttgttatgcaggttg |
243 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
13413182 |
ttgctgaggaagtgtatgttgttatgcaggttg |
13413150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 57 - 243
Target Start/End: Complemental strand, 13413150 - 13412964
Alignment:
| Q |
57 |
gaaggacgatggcttgatggatccattttaaaagcttgttttagtagactttttgagctgacggacaataaatcaaccaatgttgcaaagatgcactttt |
156 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
13413150 |
gaaggacggtggcttgatggatccattttagaagcttgttttagtagactttttgagctgatggacaataaatcaaccaatgttgcagatatgcactttt |
13413051 |
T |
 |
| Q |
157 |
tacgttgagaggttaatggtgaggcgtatggggctgtttgtgtgggaggatgatttgctgagggagtgtatgttgttatgcaggttg |
243 |
Q |
| |
|
|| |||||| ||||||||||||| |||| | ||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13413050 |
taggttgaggggttaatggtgagacgtaggaggctgtttgcgtgggaggatgatttgttgagggagtgtatgttgttatgcaggttg |
13412964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 11 - 129
Target Start/End: Original strand, 12960995 - 12961115
Alignment:
| Q |
11 |
gataatactactaggaaggtgggggatgg-atgtctacattgttttggaaggacga-tggcttgatggatccattttaaaagcttgttttagtagacttt |
108 |
Q |
| |
|
||||||| ||||| ||| |||||||||| ||||||| ||||||||||||||| || ||||||||||||| |||| |||||||||||||||| ||| |
|
|
| T |
12960995 |
gataatattactacgaaaatgggggatgggatgtctaggttgttttggaaggacatgtgacttgatggatccactttataagcttgttttagtaggtttt |
12961094 |
T |
 |
| Q |
109 |
ttgagctgacggacaataaat |
129 |
Q |
| |
|
||||| || | |||||||||| |
|
|
| T |
12961095 |
ttgagttgtctgacaataaat |
12961115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 38 - 180
Target Start/End: Complemental strand, 39223105 - 39222962
Alignment:
| Q |
38 |
ggatgtctacattgttttggaaggac-gatggcttgatggatccattttaaaagcttgttttagtagactttttgagctgacggacaataaatcaaccaa |
136 |
Q |
| |
|
|||||||||| |||||||||||| || ||||||||| |||||| |||| |||||||||| | ||| ||||||||| || |||||||||| || || |
|
|
| T |
39223105 |
ggatgtctacgttgttttggaagaactcgtggcttgatagatccactttagaagcttgtttaattaggctttttgagttggtagacaataaattaatcac |
39223006 |
T |
 |
| Q |
137 |
tgttgcaaagatgcactttttacgttgagaggttaatggtgagg |
180 |
Q |
| |
|
|||||| |||| ||||||||| |||| ||||||| ||||||| |
|
|
| T |
39223005 |
cgttgcagagatacactttttaggttgggaggttatcggtgagg |
39222962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 66 - 183
Target Start/End: Complemental strand, 33318345 - 33318228
Alignment:
| Q |
66 |
tggcttgatggatccattttaaaagcttgttttagtagactttttgagctgacggacaataaatcaaccaatgttgcaaagatgcactttttacgttgag |
165 |
Q |
| |
|
|||||||||||||| | |||| ||| |||||||||||||||||||||| || |||||||||| | | ||||||| ||||||| |||||| ||| | |
|
|
| T |
33318345 |
tggcttgatggatctactttagaagtttgttttagtagactttttgagttggttgacaataaattagaaattgttgcagagatgcaatttttaggtttaa |
33318246 |
T |
 |
| Q |
166 |
aggttaatggtgaggcgt |
183 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
33318245 |
aggttaatggtgaggcgt |
33318228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 49 - 181
Target Start/End: Complemental strand, 33317774 - 33317643
Alignment:
| Q |
49 |
ttgttttggaaggacga-tggcttgatggatccattttaaaagcttgttttagtagactttttgagctgacggacaataaatcaaccaatgttgcaaaga |
147 |
Q |
| |
|
||||||||||||||| |||||||||| ||| | ||||||||||||||||||||| ||||||||| || |||||||||| | | | ||||| ||| |
|
|
| T |
33317774 |
ttgttttggaaggacccgtggcttgatgaatctactttaaaagcttgttttagtaggctttttgagttggatgacaataaattagcaacagttgc--aga |
33317677 |
T |
 |
| Q |
148 |
tgcactttttacgttgagaggttaatggtgaggc |
181 |
Q |
| |
|
||||||||||| |||| |||||||||||||||| |
|
|
| T |
33317676 |
tgcactttttaggttggaaggttaatggtgaggc |
33317643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University