View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16697_low_38 (Length: 239)
Name: NF16697_low_38
Description: NF16697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16697_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 19 - 225
Target Start/End: Complemental strand, 25604622 - 25604416
Alignment:
| Q |
19 |
ctcatcaactggccattagaataactctttaagctgcatatcatcgagtgcaacaaatcgtgtttctccggtaattgctagacccctcaaaacaagttat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25604622 |
ctcatcaactggccattagaataactctttaagctgcatatcatcgagtgcaacaaatcgtgtttctccggtaattgctagacccctcaaaacaagttat |
25604523 |
T |
 |
| Q |
119 |
tcaccttcggagtttttaggctcaattagaacattgaatccaaattcttttcctgctgtgaatgattttttgagttcttgtatcgtttgaatagtgctaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25604522 |
tcaccttcggagtttttaggctcaattagaacattgaatccaaattcttttcctgctgtgaatgattttttgagttcttgtatcgtttgaatagtgctaa |
25604423 |
T |
 |
| Q |
219 |
ccttctt |
225 |
Q |
| |
|
||||||| |
|
|
| T |
25604422 |
ccttctt |
25604416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University