View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16697_low_42 (Length: 225)
Name: NF16697_low_42
Description: NF16697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16697_low_42 |
 | |
|
| [»] scaffold0504 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0504 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: scaffold0504
Description:
Target: scaffold0504; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 16 - 144
Target Start/End: Complemental strand, 7927 - 7799
Alignment:
| Q |
16 |
aatacatcaaacacattcaagctttcagaaacttctccatcctcagcacttgacctgttgtggttgtgcccttctaccaagttaacgtttccagaacgtt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| ||||||||||| ||||| || |
|
|
| T |
7927 |
aatacatcaaacacattcaagctttcagaaacttctccaccctcaccacttgacctgttgtggttgtgcccttctaccaggttaacgtttcgagaacctt |
7828 |
T |
|
| Q |
116 |
ctccaatctcataacttgaagatctttca |
144 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7827 |
ctccaatctcataacttgaagatctttca |
7799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 146 - 212
Target Start/End: Original strand, 12026724 - 12026790
Alignment:
| Q |
146 |
cgtcgttcacagcattttcctctggtacagagtttttgtccattggaatatctttgcaagaattatc |
212 |
Q |
| |
|
|||| ||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12026724 |
cgtcattcacagcatttttctctgggacagagtttttgtccattggaatatctttgcaagaattatc |
12026790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 78 - 134
Target Start/End: Complemental strand, 52895124 - 52895068
Alignment:
| Q |
78 |
gttgtgcccttctaccaagttaacgtttccagaacgttctccaatctcataacttga |
134 |
Q |
| |
|
||||||||| || ||||||||||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
52895124 |
gttgtgcccctcaaccaagttaacatttccagaaccttctccaaactcataacttga |
52895068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University