View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16697_low_46 (Length: 214)
Name: NF16697_low_46
Description: NF16697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16697_low_46 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 195
Target Start/End: Complemental strand, 38323135 - 38322958
Alignment:
| Q |
18 |
gaaccgtctcgtgataaagaaatttgatattcctcaatgtcgtcaacatagtctaccatttctgatgaagatattaatgccaatttttcctccttgtttc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38323135 |
gaaccgtctcgtgataaagaaatttgatattcctcaaagtcgtcaacatagtctatcatttctgatgaagatattaatgccaatttttcctccttgtttc |
38323036 |
T |
 |
| Q |
118 |
gaaaactagaatttaaagtagaaagtagcttaggaaaatctacctctactactttctctactttactttggataggat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38323035 |
gaaaactagaatttaaagtagaaagtagcttaggaaaatctacctctactactttctctactttactttggataggat |
38322958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University