View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16698_high_16 (Length: 264)
Name: NF16698_high_16
Description: NF16698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16698_high_16 |
 | |
|
| [»] scaffold0339 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0339 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 27 - 245
Target Start/End: Complemental strand, 15945 - 15726
Alignment:
| Q |
27 |
ttgtccctgctgaacttgagaactcagcnnnnnnn-ctggtgttttgagttttttcatgaaggaacttgagcaaactactagtgcctttaagatgcagcg |
125 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15945 |
ttgtccctgctgaacttgagaactcagcaaaaaaaactggtgttttgagttttttcatgaaggaacttgagcaaactactagtgcctttaagatgcagcg |
15846 |
T |
|
| Q |
126 |
agtaaacaactttattttgatatataaggatgtattcaattccttatggtaaataaaaattagtcacattgcaatcaaaattatcgggaaaaacccaagt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15845 |
agtaaacaactttattttgatatataaggatgtattcaattccttatggtaaataaaaattagtcaccttgcaatcaaaattatcgggaaaaacccaagt |
15746 |
T |
|
| Q |
226 |
accgcatcaaatagataaga |
245 |
Q |
| |
|
||| |||||||||||||||| |
|
|
| T |
15745 |
accacatcaaatagataaga |
15726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 62 - 101
Target Start/End: Original strand, 2956 - 2994
Alignment:
| Q |
62 |
ctggtgttttgagttttttcatgaaggaacttgagcaaac |
101 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2956 |
ctggtgttttgagtttt-tcatgaaggaacttgagcaaac |
2994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 62 - 101
Target Start/End: Original strand, 47273731 - 47273769
Alignment:
| Q |
62 |
ctggtgttttgagttttttcatgaaggaacttgagcaaac |
101 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47273731 |
ctggtgttttgagtttt-tcatgaaggaacttgagcaaac |
47273769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 206 - 255
Target Start/End: Original strand, 12941561 - 12941610
Alignment:
| Q |
206 |
ttatcgggaaaaacccaagtaccgcatcaaatagataagacttatgatga |
255 |
Q |
| |
|
|||| |||||||||||||||||| ||||| |||||| ||||| ||||||| |
|
|
| T |
12941561 |
ttattgggaaaaacccaagtaccacatcagatagatgagactcatgatga |
12941610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 13413575 - 13413616
Alignment:
| Q |
206 |
ttatcgggaaaaacccaagtaccgcatcaaatagataagact |
247 |
Q |
| |
|
|||| ||||||||||||||| || |||||||||||||||||| |
|
|
| T |
13413575 |
ttattgggaaaaacccaagtcccacatcaaatagataagact |
13413616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 211 - 247
Target Start/End: Complemental strand, 8044654 - 8044618
Alignment:
| Q |
211 |
gggaaaaacccaagtaccgcatcaaatagataagact |
247 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
8044654 |
gggaaaaacccaagtcccgcatcagatagataagact |
8044618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University