View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16698_high_28 (Length: 217)

Name: NF16698_high_28
Description: NF16698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16698_high_28
NF16698_high_28
[»] chr5 (1 HSPs)
chr5 (1-196)||(40753489-40753684)
[»] chr1 (1 HSPs)
chr1 (1-47)||(19472134-19472180)


Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 40753684 - 40753489
Alignment:
1 atagtggatgagattaaagttttgtcttggaaatggatgttgaatagaaccaaaagcccgacttgcttttgtttgttgaggtgaggggtgggggtgtgta 100  Q
    |||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40753684 atagtggaggagattaaagttttgtcttgaaaatggatgttgaatagaaccaaaagcccgacttgcttttgtttgttgaggtgaggggtgggggtgtgta 40753585  T
101 tgccgtgctgctgccctttagtttccttctggtgtatcggtttctactgtgagcttctgttttgccttcaatgttgtttgattcaagtatcattgt 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
40753584 tgccgtgctgctgccctttagtttccttctggtgtatcggtttctactgtgagcttctgttttgccttcaatgttgtttgatttaagtatcattgt 40753489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 19472134 - 19472180
Alignment:
1 atagtggatgagattaaagttttgtcttggaaatggatgttgaatag 47  Q
    ||||| || |||||||| ||||||||||||| |||||||||||||||    
19472134 atagttgaggagattaaggttttgtcttggagatggatgttgaatag 19472180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University