View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16698_low_13 (Length: 323)
Name: NF16698_low_13
Description: NF16698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16698_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 19 - 313
Target Start/End: Original strand, 56277810 - 56278104
Alignment:
| Q |
19 |
atcgttctacttcacatttgaagtgtactcctcagaaaccaaagcttggaagaaatccaatgagatatgcgactgtaattatgttttgattaaaaacaaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
56277810 |
atcgttctacttcacatttgaagtgtactcctcagaaaccaaagcttggaagaaatccaatgagacatgcgactgtaattatggtttgattaaaaacaaa |
56277909 |
T |
 |
| Q |
119 |
gggttatacataggaggtgtcttgcattggcttacagaaggtgatcaaatcatcacctttaatcttgaaaaggaactgtctttgatgatttcagtacctg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
56277910 |
gggttatacataggaggtgtcttgcattggcttacagaaggtgatcaaatcatcacctttaatgttgaaaaggaactgtctttgatgatttcagtacctg |
56278009 |
T |
 |
| Q |
219 |
ttcctgcatgtgagtttaggaccgtccctcaagcttgcattggagaatatgaaggaaggcttcattatgttcaggtatcagaacaaggtcttcat |
313 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56278010 |
ttccggcatgtgagtttaggaccgtccctcaagcttgcattggagaatatgaaggaaggcttcattatgttcaggtatcagaacaaggtcttcat |
56278104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University