View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16698_low_16 (Length: 274)
Name: NF16698_low_16
Description: NF16698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16698_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 9e-79; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 32 - 204
Target Start/End: Complemental strand, 5821255 - 5821084
Alignment:
| Q |
32 |
ttaacctatttttgcattctgtgacagattacaagagtaaactgtgcaaattttcagcaagtaaaaaggaacgacttgaacggcttttacatgtcattga |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5821255 |
ttaacctatttttgcattctgtgacagattacaagattaaacagtgcaa-ttttcagcaagtaaaaaggaacgacttgaacggcttttacatgtcattga |
5821157 |
T |
 |
| Q |
132 |
tgtcgatcttaactaacaagatatcttggttcttgatacttctgccaaatttttcaatgataattcaccactc |
204 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5821156 |
tgtcgatcttaactaacaagatatctttgttcttgatacttctgccaaatttttcaatgagaattcaccactc |
5821084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 204 - 254
Target Start/End: Complemental strand, 5820940 - 5820889
Alignment:
| Q |
204 |
ctctattccaaacagctcaacataagttttaattc-ctttctgaataatctg |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5820940 |
ctctattccaaacagctcaacataagttttaattcaatttctgaataatctg |
5820889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University