View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16698_low_23 (Length: 240)
Name: NF16698_low_23
Description: NF16698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16698_low_23 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 20 - 240
Target Start/End: Complemental strand, 38250320 - 38250100
Alignment:
| Q |
20 |
ttgcaccatactccaaatatgcacttgagttatatcatattaactgcgatgcaaataaatgtgcaaaccatcttgcatatcgagctcattctacttagct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38250320 |
ttgcaccatactccaaatatgcacttgagttatatcatattaactgcgatgcaaataaatgtgcaaaccatcttgcatatcgagctcattctacttagct |
38250221 |
T |
 |
| Q |
120 |
gtaatagagaaatctttgttagatattctcatatgtaatgattcccttggtgcgaattccatccgtttgggtagttaatgcaattccattattagaaagn |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38250220 |
gtaatagagaaatctttgttagatattctcatatgtaatgattcccttggtgcaaattccatccgtttgagtagttaatgcaattccattattagaaaga |
38250121 |
T |
 |
| Q |
220 |
nnnnnngaaattctttttgac |
240 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
38250120 |
aaaaaagaaattctttttgac |
38250100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 73 - 115
Target Start/End: Complemental strand, 32738705 - 32738663
Alignment:
| Q |
73 |
aataaatgtgcaaaccatcttgcatatcgagctcattctactt |
115 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||||| |
|
|
| T |
32738705 |
aataaatgtgcaaaccttctttcacatcgagctcattctactt |
32738663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 216
Target Start/End: Complemental strand, 24351405 - 24351373
Alignment:
| Q |
184 |
gtttgggtagttaatgcaattccattattagaa |
216 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
24351405 |
gtttgggtatttaatgcaattccattattagaa |
24351373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 214
Target Start/End: Complemental strand, 14618209 - 14618169
Alignment:
| Q |
174 |
aattccatccgtttgggtagttaatgcaattccattattag |
214 |
Q |
| |
|
||||||| |||||| |||||||||||||||| ||||||||| |
|
|
| T |
14618209 |
aattccacccgttttggtagttaatgcaatttcattattag |
14618169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University