View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16698_low_28 (Length: 226)
Name: NF16698_low_28
Description: NF16698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16698_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 3 - 169
Target Start/End: Original strand, 49127781 - 49127956
Alignment:
| Q |
3 |
gtagggaaggtacgtattttgggatataggataaaattttgaaaaccttcccgttgacagtgg---aatttgtaccaggaaat------gtttttcttta |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| ||||||||||| |
|
|
| T |
49127781 |
gtagggaaggtacgtattttgggatataggataaaattttgaaaaccttcccgttgacagtggtggaatttgtactaggaaatataaatgtttttcttta |
49127880 |
T |
|
| Q |
94 |
tatcacaaatatgtttttgttattaaacaacaaaaaatatacgtctttttactaataaatgtaaatttttaagcta |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49127881 |
tatcacaaatatgtttttgttattaaacaacaaaaaatatacgtctttttactaataaatgtaaatttttaagcta |
49127956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University