View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16698_low_29 (Length: 217)
Name: NF16698_low_29
Description: NF16698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16698_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 40753684 - 40753489
Alignment:
| Q |
1 |
atagtggatgagattaaagttttgtcttggaaatggatgttgaatagaaccaaaagcccgacttgcttttgtttgttgaggtgaggggtgggggtgtgta |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40753684 |
atagtggaggagattaaagttttgtcttgaaaatggatgttgaatagaaccaaaagcccgacttgcttttgtttgttgaggtgaggggtgggggtgtgta |
40753585 |
T |
 |
| Q |
101 |
tgccgtgctgctgccctttagtttccttctggtgtatcggtttctactgtgagcttctgttttgccttcaatgttgtttgattcaagtatcattgt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40753584 |
tgccgtgctgctgccctttagtttccttctggtgtatcggtttctactgtgagcttctgttttgccttcaatgttgtttgatttaagtatcattgt |
40753489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 19472134 - 19472180
Alignment:
| Q |
1 |
atagtggatgagattaaagttttgtcttggaaatggatgttgaatag |
47 |
Q |
| |
|
||||| || |||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
19472134 |
atagttgaggagattaaggttttgtcttggagatggatgttgaatag |
19472180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University