View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16698_low_30 (Length: 216)
Name: NF16698_low_30
Description: NF16698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16698_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 10 - 175
Target Start/End: Complemental strand, 40450838 - 40450673
Alignment:
| Q |
10 |
catcatcatctaagaacaaaaatatgttcctccatagctccatagaatcagatgcttctatagctttcttccttctcttttcctctttacttttcgttgc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40450838 |
catcatcatctaagaacaaaaatatgttcctccatagctccatagaatcagatgcttctatagctttcttccttctcttttcctctttacttttcgttgc |
40450739 |
T |
 |
| Q |
110 |
ttattccatttttaaacgatagctaaaattctcttatctcttttcccctttattctagttttcttc |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40450738 |
ttattccatttttaaacgatagctaaaattctcttatctcttttcccctttattctagttttcttc |
40450673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University