View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16698_low_31 (Length: 213)
Name: NF16698_low_31
Description: NF16698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16698_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 20 - 202
Target Start/End: Complemental strand, 25001011 - 25000829
Alignment:
| Q |
20 |
caccgtagacaccaaattcgcctctatctccgtcgcagaagccaaaattcacaaccatttcgctccgacgccgtctcagcttctcaaacacccactcgct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25001011 |
caccgtagacaccaaattcgcctctatctccgtcgcagaagccaaaattcacaaccatttcgctccgacgccgtctcagcttctcaaacacccactcgct |
25000912 |
T |
 |
| Q |
120 |
gcattagcgtttgttcctagagatgccgctctcttcgccgccggagcattcgccggcgctgctgctaagacgttctctgctcc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25000911 |
gcattagcgtttgttcctagagatgccgctctcttcgccgccggagcattcgccggcgctgctgctaagacgttcactgctcc |
25000829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University