View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16698_low_31 (Length: 213)

Name: NF16698_low_31
Description: NF16698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16698_low_31
NF16698_low_31
[»] chr7 (1 HSPs)
chr7 (20-202)||(25000829-25001011)


Alignment Details
Target: chr7 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 20 - 202
Target Start/End: Complemental strand, 25001011 - 25000829
Alignment:
20 caccgtagacaccaaattcgcctctatctccgtcgcagaagccaaaattcacaaccatttcgctccgacgccgtctcagcttctcaaacacccactcgct 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25001011 caccgtagacaccaaattcgcctctatctccgtcgcagaagccaaaattcacaaccatttcgctccgacgccgtctcagcttctcaaacacccactcgct 25000912  T
120 gcattagcgtttgttcctagagatgccgctctcttcgccgccggagcattcgccggcgctgctgctaagacgttctctgctcc 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
25000911 gcattagcgtttgttcctagagatgccgctctcttcgccgccggagcattcgccggcgctgctgctaagacgttcactgctcc 25000829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University