View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16699_high_15 (Length: 221)
Name: NF16699_high_15
Description: NF16699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16699_high_15 |
 |  |
|
| [»] chr7 (77 HSPs) |
 |  |
|
| [»] chr1 (84 HSPs) |
 |  |
|
| [»] chr8 (58 HSPs) |
 |  |
|
| [»] chr3 (77 HSPs) |
 |  |
|
| [»] chr5 (66 HSPs) |
 |  |
|
| [»] chr4 (94 HSPs) |
 |  |
|
| [»] chr2 (67 HSPs) |
 |  |
|
| [»] chr6 (57 HSPs) |
 |  |
|
| [»] scaffold0057 (4 HSPs) |
 |  |
|
| [»] scaffold0311 (1 HSPs) |
 |  |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |
|
| [»] scaffold0258 (1 HSPs) |
 |  |
|
| [»] scaffold1176 (1 HSPs) |
 |  |  |
|
| [»] scaffold0187 (4 HSPs) |
 |  |
|
| [»] scaffold0254 (1 HSPs) |
 |  |  |
|
| [»] scaffold0223 (1 HSPs) |
 |  |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
| [»] scaffold0180 (1 HSPs) |
 |  |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
| [»] scaffold0167 (1 HSPs) |
 |  |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
| [»] scaffold0116 (1 HSPs) |
 |  |  |
|
| [»] scaffold0954 (1 HSPs) |
 |  |  |
|
| [»] scaffold0194 (1 HSPs) |
 |  |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 8e-88; HSPs: 77)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 18 - 221
Target Start/End: Original strand, 42805449 - 42805652
Alignment:
| Q |
18 |
ttaattttattagggaaaattataaaaatgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgaggga |
117 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| ||| |
|
|
| T |
42805449 |
ttaattttattagtgaaaattataaaaatgaggggtaaccttggcgtaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctgga |
42805548 |
T |
 |
| Q |
118 |
aacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42805549 |
aacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcac |
42805648 |
T |
 |
| Q |
218 |
cggg |
221 |
Q |
| |
|
|||| |
|
|
| T |
42805649 |
cggg |
42805652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 47 - 221
Target Start/End: Original strand, 47716413 - 47716587
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| |||||| |||||||||| ||||| ||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
47716413 |
gaggggtaaccttggcacaactggaaaagttgttgccatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaa |
47716512 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
47716513 |
ggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttggtgcaccggg |
47716587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 47 - 201
Target Start/End: Original strand, 46354148 - 46354302
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||| | ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46354148 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgattggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaa |
46354247 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgc |
201 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46354248 |
ggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgc |
46354302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 47 - 221
Target Start/End: Complemental strand, 21172188 - 21172018
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |||||||||| |||||||||||| |
|
|
| T |
21172188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtaactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaacagggtaa |
21172091 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||| ||||| ||||||||||||||| |||||||||||| |
|
|
| T |
21172090 |
ggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
21172018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 46 - 221
Target Start/End: Complemental strand, 2541202 - 2541028
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaa-ggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggt |
144 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||| ||||||| |||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
2541202 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggt |
2541103 |
T |
 |
| Q |
145 |
aaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||| ||| |||||||| ||||||||||||||||||| | ||| || ||||||||||||||||||||||||| |
|
|
| T |
2541102 |
aaggctgcgtactatacacca--aatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccggg |
2541028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 47 - 221
Target Start/End: Original strand, 42798623 - 42798795
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||||||||||||||||| ||||| |
|
|
| T |
42798623 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcttggaaacagtctcttgtgtaaaaaacaaggtaa |
42798722 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||| ||||| ||||| ||||||||||||||| ||||||| |||| |
|
|
| T |
42798723 |
ggctgcgtacaatacacca--aatggtgggaccctttcccggaccctgcatatgcgggagctatagtgcatcggg |
42798795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 47 - 221
Target Start/End: Original strand, 43557426 - 43557601
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| |||| ||||||| |||||||||| ||||||| ||||||||||||||||||| |||| |
|
|
| T |
43557426 |
gaggggtaaccttgccgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaaaacagagtaa |
43557525 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagc-tttagtgcaccggg |
221 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||| ||| | || ||||||||||| |||||||||||||| |
|
|
| T |
43557526 |
ggctgcgtacaatacaccaataatggtgggaccccctcccggactctgcgtatgcgggagcttttagtgcaccggg |
43557601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 45 - 221
Target Start/End: Complemental strand, 48735304 - 48735131
Alignment:
| Q |
45 |
atgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgag-ggaaacaacctcttgtgtaaaaaacaggg |
143 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||| |||| |||||||||||||||||| |||||||||||||||||||||| || || |
|
|
| T |
48735304 |
atgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtccttggaaacaacctcttgtgtaaaacac--gg |
48735207 |
T |
 |
| Q |
144 |
taaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||| ||||| ||||||||||||||| |||||||||||| |
|
|
| T |
48735206 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
48735131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 46 - 221
Target Start/End: Original strand, 32758214 - 32758385
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||| |||| |||||||| ||||||||| ||||||| |||||||||| ||||||||||| |
|
|
| T |
32758214 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgt--aaaacagggta |
32758311 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||| ||||| ||||||||||||||| |||||||||||| |
|
|
| T |
32758312 |
aggctgtgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
32758385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 65 - 221
Target Start/End: Complemental strand, 11617751 - 11617597
Alignment:
| Q |
65 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
164 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| ||||||||| ||||||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
11617751 |
aactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaagactgcgtacaatacacc |
11617652 |
T |
 |
| Q |
165 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
| |||||||||||||||||| ||||| || ||||| ||| ||||||||||||||| |
|
|
| T |
11617651 |
a--aatggtgggaccccttcctggaccctgcgtatgcaggacctttagtgcaccggg |
11617597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 54 - 217
Target Start/End: Complemental strand, 10693245 - 10693086
Alignment:
| Q |
54 |
aaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgca |
153 |
Q |
| |
|
|||||||| | |||| |||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||||| |||| ||||||||||||| |
|
|
| T |
10693245 |
aaccttggcgcaactagtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaagagggtaaggctgcg |
10693148 |
T |
 |
| Q |
154 |
tacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
10693147 |
tacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
10693086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 67 - 218
Target Start/End: Complemental strand, 33872070 - 33871922
Alignment:
| Q |
67 |
ctggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaa |
166 |
Q |
| |
|
||||||||||||||||||||| |||| |||||| ||||||||||| ||||||||||||||||||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
33872070 |
ctggtaaagttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacaacctcttgtgta-aaaacaggataaggctgcgtacaatacacca- |
33871973 |
T |
 |
| Q |
167 |
taatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| ||||||||||||||| |
|
|
| T |
33871972 |
-aatggtgggaccccttcccagaccctgtgtatgcgagagctttagtgcacc |
33871922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 55 - 221
Target Start/End: Original strand, 27629596 - 27629760
Alignment:
| Q |
55 |
accttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcat |
154 |
Q |
| |
|
||||||| | ||||||||||||||||||||| | || | |||||||||||||||||| ||||||| |||||||||||||||||||||||||| ||| | |
|
|
| T |
27629596 |
accttggcgcaactggtaaagttgttgtcatttgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggttgcgt |
27629695 |
T |
 |
| Q |
155 |
acaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
| ||||||||| ||||||||||||||||||| | ||| |||||||||| ||||| ||||||||||| |
|
|
| T |
27629696 |
aaaatacacca--aatggtgggaccccttcccgggccctgcatatgcggtagcttcagtgcaccggg |
27629760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 45 - 221
Target Start/End: Complemental strand, 35334997 - 35334825
Alignment:
| Q |
45 |
atgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggt |
144 |
Q |
| |
|
||||||| ||||||||| | ||||||||||||||||||||||| |||||||||||||| |||||||| ||||||| ||| |||||||||||||||| |
|
|
| T |
35334997 |
atgagggataaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgagttcaagtcctggaaaca--gtctcgtgtaaaaaacagggt |
35334900 |
T |
 |
| Q |
145 |
aaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||| ||| ||||||||||| ||||||||||||||||||| ||||| || ||||| ||||||||||||||||||| |
|
|
| T |
35334899 |
aagactgtgtacaatacacc--gaatggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccggg |
35334825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 75 - 221
Target Start/End: Complemental strand, 42391251 - 42391109
Alignment:
| Q |
75 |
gttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtg |
174 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||| ||||||| | |||||||||||| |||||||||||||| ||||||||||||| |||||| |
|
|
| T |
42391251 |
gttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcttcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtg |
42391156 |
T |
 |
| Q |
175 |
ggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| |||||||||||| |
|
|
| T |
42391155 |
ggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
42391109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 47 - 221
Target Start/End: Complemental strand, 22699151 - 22698976
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| |||| ||||| | |||||||||| ||||| | ||||||||||||||||||||||| |
|
|
| T |
22699151 |
gaggggtaaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggttatgggttcaagtcctggaaatagtctcttgtgtaaaaaacagggtaa |
22699052 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccc-cttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
| |||| ||||||||||||| ||||||||||||| ||||| ||||| | |||||||||||| |||||||||||| |
|
|
| T |
22699051 |
gactgcgtacaatacaccaaaaatggtgggacccttttcccggaccctgtgtatgcgggagctatagtgcaccggg |
22698976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 46 - 218
Target Start/End: Original strand, 42476826 - 42476994
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||| ||| |||||||||| ||||||| ||||||| ||||||||| |||||| |||| |
|
|
| T |
42476826 |
tgaggggtaacattggcgtaactggtaaagttgttgtcatgtgactaaaaggtcacggattcaagttctggaaacagtctcttgtgt--aaaacaaggta |
42476923 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||| || | | ||||||||||||||| ||||||||| |
|
|
| T |
42476924 |
aggctgcgtacaatacacca--aatggtgggaccccttcctaggctctgcatatgcgggagctctagtgcacc |
42476994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 65 - 221
Target Start/End: Complemental strand, 19427052 - 19426899
Alignment:
| Q |
65 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
164 |
Q |
| |
|
||||||||||||||||||||||| || | |||||||||||||||||| ||||||| |||||||||||||||| |||||||| |||| ||||||||||| |
|
|
| T |
19427052 |
aactggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaatagggtaagactgcgtacaatacacc |
19426953 |
T |
 |
| Q |
165 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
| |||||||||| |||||| | ||||| ||||||||| |||||| ||||||||||| |
|
|
| T |
19426952 |
a--aatggtggga-cccttctcggaccctgcatatgcgagagcttcagtgcaccggg |
19426899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 94 - 221
Target Start/End: Original strand, 7879639 - 7879764
Alignment:
| Q |
94 |
aaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagacccc |
193 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||||||||| ||||||||||| |||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
7879639 |
aaggtcacgggttcaagtcctggaaacaatctcttgtgtaaaaaacaaggtaaggctgcgtacaatacacca--aatggtgggaccccttcccggaccct |
7879736 |
T |
 |
| Q |
194 |
gcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|| ||||||||||||| ||||||||||| |
|
|
| T |
7879737 |
gcgtatgcgggagcttcagtgcaccggg |
7879764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 53 - 219
Target Start/End: Original strand, 40463837 - 40464000
Alignment:
| Q |
53 |
taaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgc |
152 |
Q |
| |
|
||||||||| | ||| ||||||||||||||||||| |||| |||||||||||||||||| | |||||| ||||||||| |||||| |||||||||||| |
|
|
| T |
40463837 |
taaccttggcgcaaccggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcatagaaacagtctcttgtgt-aaaaactgggtaaggctgc |
40463935 |
T |
 |
| Q |
153 |
atacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
219 |
Q |
| |
|
|| ||||||||| ||||||||||||||||| | ||||| || ||||||||||||| ||||||||| |
|
|
| T |
40463936 |
gtataatacacca--aatggtgggaccccttctcggaccctgcgtatgcgggagcttcagtgcaccg |
40464000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 47 - 220
Target Start/End: Complemental strand, 47078034 - 47077865
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| ||||||||| |||| || |||| |
|
|
| T |
47078034 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagtctcttgtgt--aaaatagagtaa |
47077937 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
| ||| |||||||||| | |||||||||||||||||||| |||| |||||||||||||| ||||||||||| |
|
|
| T |
47077936 |
agttgcgtacaatacac--aaaatggtgggaccccttcccaaaccctacatatgcgggagctctagtgcaccgg |
47077865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 69 - 221
Target Start/End: Original strand, 16341254 - 16341405
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
|||||||||||| ||||||| || |||||||||||||||||| |||||| |||||||||||||||||||||||||||| | ||||||||||||| | |
|
|
| T |
16341254 |
ggtaaagttgttatcatgtatttgaaaggtcacgggttcaagttctagaaacagcctcttgtgtaaaaaacagggtaaggctacgtacaatacaccaa-a |
16341352 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||| || |||||| |||| |||||||||||||||| |||||||||| |
|
|
| T |
16341353 |
atggtgggccctcttcccggacctatcatatgcgggagctttggtgcaccggg |
16341405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 51 - 220
Target Start/End: Complemental strand, 14732999 - 14732831
Alignment:
| Q |
51 |
ggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggct |
150 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||| |||| || |||| |||||||||| ||||||| |||| ||||||||||||||||||||| |
|
|
| T |
14732999 |
ggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaagtcatgggttcaagtcctggaaacagcctcccatgtaaaaaacagggtaaggct |
14732900 |
T |
 |
| Q |
151 |
gcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
|| | ||||||||||| ||||||| || ||||||| |||| | |||||||||||||||||||||||| |
|
|
| T |
14732899 |
gcgt-caatacaccaaaaatggtgaaactccttcccgaaccctgtttatgcgggagctttagtgcaccgg |
14732831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 69 - 221
Target Start/End: Complemental strand, 23419833 - 23419683
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
|||||||||| |||||||| ||| |||||||| ||||||||| ||||||| ||||||||||||||||||||||||| |||| |||||||||||| | |
|
|
| T |
23419833 |
ggtaaagttgctgtcatgtgactaaaaggtcacaggttcaagttctggaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacca--a |
23419736 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||||||||| ||||| || | |||||| ||||||||||| |||| |
|
|
| T |
23419735 |
atggtgggaccccttcctagaccttgcgtgtgcgggggctttagtgcatcggg |
23419683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 69 - 221
Target Start/End: Complemental strand, 28362304 - 28362155
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
||||||||||||||||||| ||| |||||||| ||||||||| ||||| ||||||||||||||||| ||||||||||| |||||||||||| | |
|
|
| T |
28362304 |
ggtaaagttgttgtcatgtggctgaaaggtcacaggttcaagtcctagaaactgcctcttgtgtaaaaaacttggtaaggctgcgtacaatacacca--a |
28362207 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||||| |||||||||| |
|
|
| T |
28362206 |
atggtgggaccccttcccagaccttgcatatgtgggagcttt-gtgcaccggg |
28362155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 45 - 213
Target Start/End: Complemental strand, 34626390 - 34626225
Alignment:
| Q |
45 |
atgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggt |
144 |
Q |
| |
|
||||||||||||||| | | ||||||||||||||||||||||| | || |||| ||| | ||||||| ||||||| |||| ||||| ||||||||||| |
|
|
| T |
34626390 |
atgaggggtaaccttagcgcaactggtaaagttgttgtcatgtgattgaaaggccacagattcaagtcctggaaacagcctcctgtgt-aaaaacagggt |
34626292 |
T |
 |
| Q |
145 |
aaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagt |
213 |
Q |
| |
|
|||||||| | |||||||||| |||||||||| |||||||| ||||| || ||||||||||||||||| |
|
|
| T |
34626291 |
aaggctgcgttcaatacacca--aatggtgggatcccttcccggaccctgcgtatgcgggagctttagt |
34626225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 69 - 221
Target Start/End: Original strand, 29907393 - 29907544
Alignment:
| Q |
69 |
ggtaaagttgttgt--catgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaa |
166 |
Q |
| |
|
|||||||||||||| ||||| |||| |||||||||||||||||| |||||| |||||||||||||||| || |||||||||| | ||||||||||| |
|
|
| T |
29907393 |
ggtaaagttgttgtatcatgtgactgaaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaaatagtgtaaggctgcgttcaatacaccaa |
29907492 |
T |
 |
| Q |
167 |
taatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||| |||| ||||| | ||||||||||||||||||||||||| |
|
|
| T |
29907493 |
-aatggtgggaccccatcccggaccctg--tatgcgggagctttagtgcaccggg |
29907544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 43 - 166
Target Start/End: Original strand, 12473254 - 12473377
Alignment:
| Q |
43 |
aaatgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagg |
142 |
Q |
| |
|
|||||||||||| |||||| | ||| |||||||||||||||||||| ||| ||||||| |||||||||| | |||||||||||||||| ||||||||| |
|
|
| T |
12473254 |
aaatgaggggtagccttggcgcaaccggtaaagttgttgtcatgtatctgaaaggtcatgggttcaagtcctgcaaacaacctcttgtgtcaaaaacagg |
12473353 |
T |
 |
| Q |
143 |
gtaaggctgcatacaatacaccaa |
166 |
Q |
| |
|
|||||| ||| ||||||||||||| |
|
|
| T |
12473354 |
gtaaggatgcgtacaatacaccaa |
12473377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 69 - 221
Target Start/End: Original strand, 19265791 - 19265939
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
|||||||||||||||| || |||| |||||||||||||||||| ||| ||| || ||||||| ||||| ||||||||||||| |||||||||||| | |
|
|
| T |
19265791 |
ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcttggatacagccgcttgtgt-aaaaagagggtaaggctgcgtacaatacacca--a |
19265887 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||||| || || |||||| |||||||||||||||||||| |
|
|
| T |
19265888 |
atggtgggaccccttcccgga-cctacatatgtgggagctttagtgcaccggg |
19265939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 48 - 151
Target Start/End: Original strand, 18326989 - 18327091
Alignment:
| Q |
48 |
aggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaag |
147 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| ||| ||||||||||||||||||| ||||||| |||||||||| |||||||||||||| |
|
|
| T |
18326989 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgacttgaaggtcacgggttcaagtcccggaaacagcctcttgtgt-aaaaacagggtaag |
18327087 |
T |
 |
| Q |
148 |
gctg |
151 |
Q |
| |
|
|||| |
|
|
| T |
18327088 |
gctg |
18327091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 84 - 220
Target Start/End: Complemental strand, 38262340 - 38262206
Alignment:
| Q |
84 |
atgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggacccctt |
183 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||| ||||||||||||||| | ||||| | |||||||||||||||| |||| ||||||||||| |
|
|
| T |
38262340 |
atgtgactggaaggtcacgggttcaagtcctggaaacagtctcttgtgtaaaaaatatggtaatgttgcatacaatacacca--aatgatgggacccctt |
38262243 |
T |
 |
| Q |
184 |
cccagaccccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
||| || | || |||||||||||||||||||||||| |
|
|
| T |
38262242 |
cccgaacactgcgtatgcgggagctttagtgcaccgg |
38262206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 47 - 220
Target Start/End: Complemental strand, 2663112 - 2662946
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| | |||| ||||||||||||| |||| |||||| |||| ||||||||| ||||||| |||||||||| |||| ||||||| |
|
|
| T |
2663112 |
gaggggtaaccttggcgcaactagtaaagttgttgttatgtgactgga--gtcataggttcaagtcctggaaacagcctcttgtgt--aaaatagggtaa |
2663017 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
|||||| |||||||||||| |||||||||| ||||| ||||||| ||||||||||||||| ||| ||||||| |
|
|
| T |
2663016 |
ggctgcgtacaatacacca--aatggtggga-cccttttcagaccctgcatatgcgggagctctagcgcaccgg |
2662946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 48 - 216
Target Start/End: Complemental strand, 5180337 - 5180169
Alignment:
| Q |
48 |
aggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaag |
147 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||| |||| ||||||| |||||||| | ||||||| |||||||||| |||||||||||||| |
|
|
| T |
5180337 |
aggggtaaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggtcaagggttcaacttctggaaacagcctcttgtgtcaaaaacagggtaag |
5180238 |
T |
 |
| Q |
148 |
gctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
216 |
Q |
| |
|
||| ||||| ||||||| |||| | ||||||||| ||| | || | ||||| ||||||||| |||| |
|
|
| T |
5180237 |
actgtgtacaacacaccaaaaatgattggacccctttccaaatcctacgtatgcaggagctttaatgca |
5180169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 47 - 151
Target Start/End: Original strand, 7193039 - 7193143
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||| |||| |||||||||||||||||| |||||||||||||||||||| || | ||||| |
|
|
| T |
7193039 |
gaggggtaaccttggcgtaacttgtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctcgaaacaacctcttgtgtaaacaatatggtaa |
7193138 |
T |
 |
| Q |
147 |
ggctg |
151 |
Q |
| |
|
||||| |
|
|
| T |
7193139 |
ggctg |
7193143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 48 - 190
Target Start/End: Complemental strand, 8149126 - 8148985
Alignment:
| Q |
48 |
aggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtg-taaaaaacagggtaa |
146 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||| |||| || |||||| |||||||| | |||| |||||||||| ||||||| ||||||| |
|
|
| T |
8149126 |
aggggtaaccttggcacaactggtaatgttgttgtcatgtgactgcaaagtcacgagttcaagtcctgaaaactacctcttgtgttaaaaaatagggtaa |
8149027 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagac |
190 |
Q |
| |
|
|| ||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8149026 |
ggttgcgtacaatacacca--aatggtgggaccccttcccagac |
8148985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 94 - 217
Target Start/End: Complemental strand, 18512586 - 18512466
Alignment:
| Q |
94 |
aaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagacccc |
193 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||| ||||||||||||| ||||||||||| | |||||||||||||||||| ||||| |
|
|
| T |
18512586 |
aaggtcacgggttcaagtcctggaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttcccggaccct |
18512490 |
T |
 |
| Q |
194 |
gcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
|| |||||||||||||| |||||| |
|
|
| T |
18512489 |
gcgtatgcgggagctttggtgcac |
18512466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 79 - 221
Target Start/End: Original strand, 18747472 - 18747613
Alignment:
| Q |
79 |
ttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaa-cagggtaaggctgcatacaatacaccaataatggtggga |
177 |
Q |
| |
|
|||||| || |||| ||||||||||| |||||| ||||||| ||| |||||||||||| |||||||||||||| || ||||||||||| |||||||| |
|
|
| T |
18747472 |
ttgtcacgtgactgaaaggtcacgggatcaagtcttggaaacagccttttgtgtaaaaaagcagggtaaggctgcgtataatacaccaat--tggtggga |
18747569 |
T |
 |
| Q |
178 |
ccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||| |||| || ||||||||||||||||||||||||| |
|
|
| T |
18747570 |
ccccttcctgaaccctgcgtatgcgggagctttagtgcaccggg |
18747613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 97 - 221
Target Start/End: Original strand, 21566439 - 21566562
Alignment:
| Q |
97 |
gtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgca |
196 |
Q |
| |
|
||||| ||||||||| |||||| ||||||||||||||||||| | ||| |||| ||||||||||||| |||||| |||||||||||| |||| ||| |
|
|
| T |
21566439 |
gtcacaggttcaagtcttggaaaccgcctcttgtgtaaaaaacagaggaagactgcgtacaatacaccaa-aatggtaggaccccttcccgaaccctgca |
21566537 |
T |
 |
| Q |
197 |
tatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
21566538 |
tatgcgggagctttagtgcaccggg |
21566562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 65 - 171
Target Start/End: Complemental strand, 1424073 - 1423967
Alignment:
| Q |
65 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
164 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||| ||||| | ||||||| || |||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
1424073 |
aactggtaaagttgttgttatgtgactggaaggtcacggattcaaatcctggaaacagtctgttgtgtaaaaaacagggtaatgctgcatacactacacc |
1423974 |
T |
 |
| Q |
165 |
aataatg |
171 |
Q |
| |
|
||||||| |
|
|
| T |
1423973 |
aataatg |
1423967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 56 - 209
Target Start/End: Original strand, 19266414 - 19266564
Alignment:
| Q |
56 |
ccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcata |
155 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||| |||| |||||| |||||||||| | ||| | || |||| |||||||||||||||||||||| || |
|
|
| T |
19266414 |
ccttggtgcaac-ggtaaagttgttgtcatgtgactgaaaggtcgtgggttcaagtcctgaaaatagccacttgcgtaaaaaacagggtaaggctgcgta |
19266512 |
T |
 |
| Q |
156 |
caatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctt |
209 |
Q |
| |
|
|||||||||| ||| |||||| |||||||| ||||| || ||||||||||||| |
|
|
| T |
19266513 |
caatacacca--aattgtgggatcccttcccggaccctgcgtatgcgggagctt |
19266564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 46 - 211
Target Start/End: Complemental strand, 28078313 - 28078151
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
|||||||||||| ||| | |||| || ||||||||||||||| |||| |||||||||||||||||| |||||| ||| ||| ||||||||||||| |
|
|
| T |
28078313 |
tgaggggtaaccctggcgcaactcgtgaagttgttgtcatgtgactgtaaggtcacgggttcaagtcctagaaacagtctcgtgta-aaaaaacagggta |
28078215 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttta |
211 |
Q |
| |
|
||| ||||| |||||||||| ||||||||||||||||||| | || ||||||||| |||||||| |
|
|
| T |
28078214 |
aggttgcatgcaatacacca--aatggtgggaccccttcccgaatcctgcatatgcgagagcttta |
28078151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 69 - 206
Target Start/End: Complemental strand, 48123643 - 48123508
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||| |||||||||| ||||||| ||||||||||||| |||||||||| ||||||||||||||||| | |
|
|
| T |
48123643 |
ggtaaagttgttatcatgtgtctgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaataacagggtaaaactgcatacaatacacca--a |
48123546 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggag |
206 |
Q |
| |
|
||||||||||||||| | |||| ||||||||||||| |
|
|
| T |
48123545 |
atggtgggacccctttctggaccatgcatatgcgggag |
48123508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 69 - 215
Target Start/End: Complemental strand, 3469338 - 3469190
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaa--cagggtaaggctgcatacaatacaccaa |
166 |
Q |
| |
|
||||||||||||||||||| |||| |||||||| | |||||| |||||| ||||||||||||||| ||||||| || ||| ||||||||||||| |
|
|
| T |
3469338 |
ggtaaagttgttgtcatgtgactgaaaggtcacagactcaagtcctagaaacattctcttgtgtaaaaaaaacagggtacggttgcgtacaatacaccaa |
3469239 |
T |
 |
| Q |
167 |
taatggtgggaccccttcccagaccccgcatatgcgggagctttagtgc |
215 |
Q |
| |
|
||||| |||||||||||| |||||| | ||||||||||||||||||| |
|
|
| T |
3469238 |
aaatggcgggaccccttcctagaccctgtgtatgcgggagctttagtgc |
3469190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 94 - 221
Target Start/End: Complemental strand, 31591241 - 31591118
Alignment:
| Q |
94 |
aaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagacccc |
193 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||| ||| |||||||||| ||||||||| || |||||||||||||||||| |||| |
|
|
| T |
31591241 |
aaggtcacgagttcaagtcctggaaacaacctcttgtgtaaaa--cagagtaaggctgcgtacaatacaataa--atggtgggaccccttcccggacctt |
31591146 |
T |
 |
| Q |
194 |
gcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||||||| |||||||||||| |
|
|
| T |
31591145 |
gcatatgcgggagctctagtgcaccggg |
31591118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 45 - 148
Target Start/End: Complemental strand, 42496018 - 42495916
Alignment:
| Q |
45 |
atgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggt |
144 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||| | |||| |||||||||||||||||| ||||||| |||||||| | ||||||||||| |
|
|
| T |
42496018 |
atgaggggtaaccttggcgcaactggtaaagttgttgtcatatgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtat-aaaaacagggt |
42495920 |
T |
 |
| Q |
145 |
aagg |
148 |
Q |
| |
|
|||| |
|
|
| T |
42495919 |
aagg |
42495916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 69 - 186
Target Start/End: Complemental strand, 14099165 - 14099050
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
||||||||||||||||||| |||| ||||||| ||||| |||| ||||| | ||| |||||||||||||||| |||| |||| |||||||||||| | |
|
|
| T |
14099165 |
ggtaaagttgttgtcatgtgactgaaaggtcatgggttgaagtcctggaaatagccttttgtgtaaaaaacaggttaagactgcgtacaatacacca--a |
14099068 |
T |
 |
| Q |
169 |
atggtgggaccccttccc |
186 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
14099067 |
atggtgggaccccttccc |
14099050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 69 - 186
Target Start/End: Complemental strand, 14409182 - 14409067
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
||||||||||||||||||| |||| ||||||| ||||| |||| ||||| | ||| |||||||||||||||| |||| |||| |||||||||||| | |
|
|
| T |
14409182 |
ggtaaagttgttgtcatgtgactgaaaggtcatgggttgaagtcctggaaatagccttttgtgtaaaaaacaggttaagactgcgtacaatacacca--a |
14409085 |
T |
 |
| Q |
169 |
atggtgggaccccttccc |
186 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
14409084 |
atggtgggaccccttccc |
14409067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 76 - 221
Target Start/End: Complemental strand, 32233286 - 32233144
Alignment:
| Q |
76 |
ttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgg |
175 |
Q |
| |
|
||||||||| | |||| ||||||| |||||||||| ||||||||||||||||||||||| ||||||||||| || || | |||||||| ||||||| |
|
|
| T |
32233286 |
ttgttgtcacctgactgaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaa-cagggtaaggcagcgtatattacaccaa--atggtgg |
32233190 |
T |
 |
| Q |
176 |
gaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|| |||||||| |||| ||||||| |||||||| ||||||||||| |
|
|
| T |
32233189 |
gattccttcccaaaccctgcatatgagggagcttcagtgcaccggg |
32233144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 68 - 185
Target Start/End: Original strand, 7644931 - 7645047
Alignment:
| Q |
68 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaat |
167 |
Q |
| |
|
||||||| ||||||| | || |||| |||||||||||||||||| ||||||| ||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
7644931 |
tggtaaatttgttgtaacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaagatagcgtacaatacaccaa- |
7645029 |
T |
 |
| Q |
168 |
aatggtgggaccccttcc |
185 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
7645030 |
aattgtgggaccccttcc |
7645047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 68 - 218
Target Start/End: Original strand, 39123865 - 39124018
Alignment:
| Q |
68 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta----aggctgcatacaatacac |
163 |
Q |
| |
|
|||||||||||||||||||| |||| || | ||||||||||||| ||||| |||||||||||||| ||||||| ||||||| || ||||||| |
|
|
| T |
39123865 |
tggtaaagttgttgtcatgtgactgaaacgacacgggttcaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacac |
39123963 |
T |
 |
| Q |
164 |
caataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
||| ||||||||||||||||||| ||||| || |||| ||||||||| ||||||| |
|
|
| T |
39123964 |
caaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcacc |
39124018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 115 - 221
Target Start/End: Original strand, 38604549 - 38604653
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttt-agt |
213 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||| |||||||||||| ||||||| |||||||| || ||||| || |||||||||||||| ||| |
|
|
| T |
38604549 |
ggaaacagcctcttgtgtaaaa-acagggtaaggctgcgtacaatacacca--aatggtgagacccctttccggaccctgcgtatgcgggagctttaagt |
38604645 |
T |
 |
| Q |
214 |
gcaccggg |
221 |
Q |
| |
|
|||||||| |
|
|
| T |
38604646 |
gcaccggg |
38604653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 72 - 221
Target Start/End: Original strand, 11741774 - 11741919
Alignment:
| Q |
72 |
aaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatg |
171 |
Q |
| |
|
|||||||||||||||| |||| ||||||| |||||||||| | ||||| | ||| |||| |||| ||||||||||||| |||||||||||| |||| |
|
|
| T |
11741774 |
aaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctgaaaacagcttctagtgt--aaaatagggtaaggctgcgtacaatacacca--aatg |
11741869 |
T |
 |
| Q |
172 |
gtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||| |||||||| || | ||| ||||||||||| |||||||||||| |
|
|
| T |
11741870 |
gtgggatcccttcccggattctgcacatgcgggagctctagtgcaccggg |
11741919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 68 - 210
Target Start/End: Original strand, 13805077 - 13805216
Alignment:
| Q |
68 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaat |
167 |
Q |
| |
|
|||||||||||||||||||| |||| ||||| |||||||||||| ||||| | ||||| |||||||| | ||||||||||| |||||||||||| |
|
|
| T |
13805077 |
tggtaaagttgttgtcatgtgactgaaaggtaacgggttcaagtcctggaaatagcctctggtgtaaaaca-ggggtaaggctgtgtacaatacacca-- |
13805173 |
T |
 |
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagcttt |
210 |
Q |
| |
|
|||||||||||| ||||| ||||| || |||||||||||||| |
|
|
| T |
13805174 |
aatggtgggaccacttcctggaccctgcgtatgcgggagcttt |
13805216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 52 - 150
Target Start/End: Complemental strand, 7794682 - 7794582
Alignment:
| Q |
52 |
gtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgt--aaaaaacagggtaaggc |
149 |
Q |
| |
|
|||||||| | | |||||||||||||||||| |||| ||||||||||||||||||||||| ||||||| |||||| ||| ||||||||||||||||| |
|
|
| T |
7794682 |
gtaaccttagcgcaactggtaaagttgttgttatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttatgtaaaaaaaacagggtaaggc |
7794583 |
T |
 |
| Q |
150 |
t |
150 |
Q |
| |
|
| |
|
|
| T |
7794582 |
t |
7794582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 47 - 139
Target Start/End: Original strand, 21447544 - 21447636
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaac |
139 |
Q |
| |
|
||||||||||||||| | ||||| |||| |||||||||||||| ||||||||||||| ||||||| | ||||| ||||||||||||||||| |
|
|
| T |
21447544 |
gaggggtaaccttggcgcaactgataaatttgttgtcatgtaattggaaggtcacggattcaagtcttgaaaacagcctcttgtgtaaaaaac |
21447636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 94 - 185
Target Start/End: Original strand, 35203440 - 35203531
Alignment:
| Q |
94 |
aaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcc |
185 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||||| |||| |||| ||||||| ||||| |||||||||| ||||||| |
|
|
| T |
35203440 |
aaggtcacgggttcaagtcctggaaacattctcttgtgtaaaaaacaggataagactgcgtacaatataccaaaaatggtgggatcccttcc |
35203531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 70 - 166
Target Start/End: Original strand, 6736867 - 6736962
Alignment:
| Q |
70 |
gtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaa |
166 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||| |||||||||||||| | ||||||| |||||| |||||||||||||||||| |
|
|
| T |
6736867 |
gtaaagttgttgtcatgcgactgaaaggtcacgggttcaagtcctcaaaacaacctcttgtat-aaaaacaaggtaagactgcatacaatacaccaa |
6736962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 123 - 220
Target Start/End: Original strand, 1408487 - 1408582
Alignment:
| Q |
123 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||| || ||||||||||||||||||| ||||| || ||||| | | ||||||| |||||| |
|
|
| T |
1408487 |
cctcttgtgtaaaaaacaaggtaaggctgtgtacaatacagca--aatggtgggaccccttcccggaccctgcgtatgcagaatctttagttcaccgg |
1408582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 69 - 215
Target Start/End: Complemental strand, 42102044 - 42101899
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
|||||||||||||||| || |||||||||||| |||||||| ||||||| |||||| |||||||||||||||| |||| |||| ||| | || | |
|
|
| T |
42102044 |
ggtaaagttgttgtcacgtgactggaaggtcaaaagttcaagtcctggaaacagcctcttccgtaaaaaacagggtaacactgcgtacagtactctaa-a |
42101946 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgc |
215 |
Q |
| |
|
||||||||||| ||||| ||||| || ||| ||| ||||||||||| |
|
|
| T |
42101945 |
gtggtgggaccctttcccggaccctgcgtatccggcagctttagtgc |
42101899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 69 - 150
Target Start/End: Original strand, 5814447 - 5814528
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggct |
150 |
Q |
| |
|
|||||||||||||| |||| | ||||| ||||||||||||||| ||||| |||||||| ||||||||| ||||||||||| |
|
|
| T |
5814447 |
ggtaaagttgttgttatgtgattggaaagtcacgggttcaagttttggaaagaacctcttatgtaaaaaatagggtaaggct |
5814528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 145 - 221
Target Start/End: Complemental strand, 27889399 - 27889325
Alignment:
| Q |
145 |
aaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||| ||||| || |||||||||||||| || ||||||| |
|
|
| T |
27889399 |
aaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttggtacaccggg |
27889325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 118 - 221
Target Start/End: Complemental strand, 35787378 - 35787278
Alignment:
| Q |
118 |
aacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
|||| ||||||||||||||| || ||||||| ||| ||||||||||||| |||| ||||||||||||| |||| || ||||||||||||| | ||||| |
|
|
| T |
35787378 |
aacagcctcttgtgtaaaaa-catggtaaggttgcgtacaatacaccaa--atggcgggaccccttcccggaccttgcgtatgcgggagcttcaatgcac |
35787282 |
T |
 |
| Q |
218 |
cggg |
221 |
Q |
| |
|
|||| |
|
|
| T |
35787281 |
cggg |
35787278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 136 - 215
Target Start/End: Original strand, 33500556 - 33500635
Alignment:
| Q |
136 |
aaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgc |
215 |
Q |
| |
|
|||||||||||| |||| ||| |||||| || ||||||||||||||||||| ||||| || ||||||||| ||| ||||| |
|
|
| T |
33500556 |
aaacagggtaagactgcgtactatacacaaaaaatggtgggaccccttcccggaccctgcgtatgcgggatcttcagtgc |
33500635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 219
Target Start/End: Original strand, 23231587 - 23231681
Alignment:
| Q |
123 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
219 |
Q |
| |
|
|||||||||||||| | | ||||||||||| || |||||||| | ||| |||||||||||||| |||| || ||||||| ||||||||||||||| |
|
|
| T |
23231587 |
cctcttgtgtaaaatataaggtaaggctgcgtataatacaccga--atgatgggaccccttcccgaaccctgcgtatgcggcagctttagtgcaccg |
23231681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 56 - 165
Target Start/End: Complemental strand, 44123792 - 44123685
Alignment:
| Q |
56 |
ccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcata |
155 |
Q |
| |
|
|||||||| ||| |||||||||| |||||||| |||| ||| | |||||||||||| ||||||| ||||||||||| |||||| ||||||| ||||| |
|
|
| T |
44123792 |
ccttggtgcaac-ggtaaagttggtgtcatgtgactgaaagattacgggttcaagtactggaaacagcctcttgtgta-aaaacaaggtaaggttgcatg |
44123695 |
T |
 |
| Q |
156 |
caatacacca |
165 |
Q |
| |
|
||||||||| |
|
|
| T |
44123694 |
aaatacacca |
44123685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 68 - 160
Target Start/End: Original strand, 22065563 - 22065654
Alignment:
| Q |
68 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaata |
160 |
Q |
| |
|
||||||||||||||||| || | || || |||| | |||||||| |||||||||||||||||| ||||| ||||||| ||||||||||||| |
|
|
| T |
22065563 |
tggtaaagttgttgtcacgtgattgaaaagtcatgagttcaagttttggaaacaacctcttgtgt-aaaaatagggtaaagctgcatacaata |
22065654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 50 - 150
Target Start/End: Complemental strand, 29140538 - 29140438
Alignment:
| Q |
50 |
gggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggc |
149 |
Q |
| |
|
|||||| ||||| | |||||||||||||||||||||||||||| |||||||| ||||||| | |||||| ||||| |||||||| | |||||||| |
|
|
| T |
29140538 |
gggtaatcttggcgcaactggtaaagttgttgtcatgtaactgaaaggtcacacattcaagttttgaaaacaatctcttaggtaaaaaataaggtaaggc |
29140439 |
T |
 |
| Q |
150 |
t |
150 |
Q |
| |
|
| |
|
|
| T |
29140438 |
t |
29140438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 145 - 218
Target Start/End: Complemental strand, 45019010 - 45018935
Alignment:
| Q |
145 |
aaggctgcatacaatacaccaataa--tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
|||||||| ||||||| ||||| || |||||| |||||||||| ||||| || |||||||||||||||||||||| |
|
|
| T |
45019010 |
aaggctgcgtacaatataccaaaaaactggtggaaccccttcccggaccctgcgtatgcgggagctttagtgcacc |
45018935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 115 - 221
Target Start/End: Original strand, 27697459 - 27697565
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggt--gggacccctt-cccagaccccgcatatgcgggagcttta |
211 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||| | |||||||||| |||||| ||||||| || ||||||||| || ||||||||||||| | |
|
|
| T |
27697459 |
ggaaacaacctcttgtgtaaaaatcagggcaaggctg--tgtaatacaccaa-aatggtgggggaccctttccccagaccctgcgtatgcgggagcttaa |
27697555 |
T |
 |
| Q |
212 |
gtgcaccggg |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
27697556 |
atgcaccggg |
27697565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 129 - 219
Target Start/End: Complemental strand, 13792250 - 13792161
Alignment:
| Q |
129 |
gtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
219 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||| | ||||| ||||||||||| | |||| || ||||| |||||||| |||||||| |
|
|
| T |
13792250 |
gtgtaaaaaacttggtaagactgcatacaatacaccca-aatggcgggaccccttctcgaaccctgcgtatgctggagcttttgtgcaccg |
13792161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 50 - 221
Target Start/End: Original strand, 25198679 - 25198852
Alignment:
| Q |
50 |
gggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttc---aagtgagggaaacaacctcttgtgt-aaaaaacagggta |
145 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| | |||| ||| ||| ||| || |||| ||||||| || |||||| |||||||| |||| |
|
|
| T |
25198679 |
gggtaaccttggcgtaactggtaaagttgttgtcatatgactgaaagatcatgggatcaaaaagtcttggaaacagtcttttgtgtaaaaaaacaaggta |
25198778 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|| | || || ||| ||| | |||||| ||| |||||||||||||| | |||| | |||||||||||||||||| |
|
|
| T |
25198779 |
agaccgcgtataatgcacta--aatggtaggatcccttcccagacccttcgtatgtgagagctttagtgcaccggg |
25198852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 136 - 221
Target Start/End: Complemental strand, 39093532 - 39093448
Alignment:
| Q |
136 |
aaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||| ||| |||||||||||| |||| |||||| |||||||| || | |||||||| | ||||||||||||||||| |
|
|
| T |
39093532 |
aaacagggtaagactgtgtacaatacacca-taatagtgggaacccttcccggaacttgcatatgcagaagctttagtgcaccggg |
39093448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 130 - 186
Target Start/End: Complemental strand, 17048914 - 17048859
Alignment:
| Q |
130 |
tgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttccc |
186 |
Q |
| |
|
||||||||||||||||||| | | ||||||||||||| |||||||| |||||||||| |
|
|
| T |
17048914 |
tgtaaaaaacagggtaaggttacgtacaatacaccaa-aatggtggaaccccttccc |
17048859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 124 - 219
Target Start/End: Original strand, 25434050 - 25434144
Alignment:
| Q |
124 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
219 |
Q |
| |
|
|||||||| |||||||| |||||| ||||||||| ||||||| |||||| ||| |||| ||||| || ||||||||||||||||||||||| |
|
|
| T |
25434050 |
ctcttgtgcaaaaaacatggtaagagtgcatacaacacaccaa-aatggtatgacttcttcttggaccctgcgtatgcgggagctttagtgcaccg |
25434144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 124 - 217
Target Start/End: Complemental strand, 21139851 - 21139761
Alignment:
| Q |
124 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
|||||||||||||| ||| |||||| || ||||| |||||||| |||||||||||||||||| || | | ||||||| ||||||||||||| |
|
|
| T |
21139851 |
ctcttgtgtaaaaa-cagagtaaggttggatacagtacaccaa--atggtgggaccccttcccgaactctgtgtatgcggaagctttagtgcac |
21139761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 36602535 - 36602573
Alignment:
| Q |
183 |
tcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
36602535 |
tcccagaccctgcgtatgcgggagctttagtgcaccggg |
36602573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 217
Target Start/End: Original strand, 45811920 - 45811969
Alignment:
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
|||||||||| ||||| |||||||| || ||||| ||||||||||||||| |
|
|
| T |
45811920 |
aatggtgggatccctttccagaccctgcttatgcaggagctttagtgcac |
45811969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 84)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 47 - 221
Target Start/End: Complemental strand, 20004273 - 20004099
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||||| |||||||||||| ||||| |
|
|
| T |
20004273 |
gaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctctcgtgtaaaaaacaaggtaa |
20004174 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20004173 |
ggctgcgtacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
20004099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 53 - 219
Target Start/End: Complemental strand, 30395903 - 30395737
Alignment:
| Q |
53 |
taaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgc |
152 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||| ||| |||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30395903 |
taaccttggcgcaactggtaaagttgttgtcatgtgactttaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgc |
30395804 |
T |
 |
| Q |
153 |
atacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30395803 |
gtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccg |
30395737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 47 - 221
Target Start/End: Original strand, 46991781 - 46991953
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46991781 |
gaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaa |
46991880 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| ||||| || |||| |||||||||||||||||||| |
|
|
| T |
46991881 |
ggctgtgtacaatacacc--gaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccggg |
46991953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 47 - 221
Target Start/End: Original strand, 18944620 - 18944795
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||| |||| |||||||| |||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
18944620 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaaggcctggaaacagcctcttgtgtaaaaaacagggtaa |
18944719 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagc-tttagtgcaccggg |
221 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||| ||||| || ||||||||||| |||||||||||||| |
|
|
| T |
18944720 |
ggctgcgtacaatacaccaacaatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccggg |
18944795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 46 - 221
Target Start/End: Complemental strand, 34725278 - 34725107
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||||| ||||||||||| |
|
|
| T |
34725278 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaacagggta |
34725181 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||| |||||||||| | ||||||||||||||||||| ||||| ||||||||||||||| |||||||||||| |
|
|
| T |
34725180 |
aggctgcgtacaatacacta--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
34725107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 65 - 216
Target Start/End: Complemental strand, 23768483 - 23768334
Alignment:
| Q |
65 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
164 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| ||||||||| | ||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23768483 |
aactggtaaagttgttgtcatgtgactgtaaggtcacaggttcaagtcatggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacacc |
23768384 |
T |
 |
| Q |
165 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
216 |
Q |
| |
|
| ||||||||||| ||||||||||||| || |||||||||||||||||||| |
|
|
| T |
23768383 |
a--aatggtgggacaccttcccagaccctgcgtatgcgggagctttagtgca |
23768334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 47 - 218
Target Start/End: Complemental strand, 32632737 - 32632569
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||| | |||| |||||||||||||||||| ||||||| ||||||||||| |||||||||||| |
|
|
| T |
32632737 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatatgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgta-aaaacagggtaa |
32632639 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||| |||| |||||||||||||||| |||||||| |
|
|
| T |
32632638 |
ggctgcgtacaatacacca--aatggtgggaccccttcccaaaccctgcatatgcgggagcttgagtgcacc |
32632569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 47 - 221
Target Start/End: Original strand, 10668197 - 10668376
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaa-----ctggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacag |
141 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||| | ||| |||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
10668197 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacaa |
10668296 |
T |
 |
| Q |
142 |
ggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||||| | ||| || ||||||||||||||||||||||||| |
|
|
| T |
10668297 |
ggtaaggttgcgtacaatacaccaataatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccggg |
10668376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 47 - 221
Target Start/End: Complemental strand, 46248134 - 46247962
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||| || ||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
46248134 |
gaggggtaaccttggctcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaagtcttggaaacagcctcttgtgtaaaaaacagggtaa |
46248035 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
| |||| |||||||||||| ||||||||||||||||||| ||||| || |||||||||||||||||| |||||| |
|
|
| T |
46248034 |
gactgcgtacaatacacca--aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccggg |
46247962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 46 - 216
Target Start/End: Original strand, 27201623 - 27201793
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
|||||||||||||| | |||| |||||||||||||||||||| |||| ||||||| |||||||||| ||||||| |||||||||| | |||||||||| |
|
|
| T |
27201623 |
tgaggggtaaccttagcgtaaatggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtcagaaacagggta |
27201722 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
216 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||||||||| |||| || |||||||||||||||||||| |
|
|
| T |
27201723 |
aggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccttgcgtatgcgggagctttagtgca |
27201793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 45 - 221
Target Start/End: Original strand, 14617013 - 14617187
Alignment:
| Q |
45 |
atgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggt |
144 |
Q |
| |
|
||||||||||||||||| | ||| ||||||||||||||||||| |||| ||||||||| |||||||| ||||||| ||||||||||||| |||| ||| |
|
|
| T |
14617013 |
atgaggggtaaccttggcgcaaccggtaaagttgttgtcatgtgactgaaaggtcacgagttcaagtcctggaaacagcctcttgtgtaaataacaaggt |
14617112 |
T |
 |
| Q |
145 |
aaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||| ||| |||||||||||| |||||||||| |||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
14617113 |
aaggttgcgtacaatacacca--aatggtgggatcccttcccggaccctgcatatgcgggagctttagtgcaccggg |
14617187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 47 - 218
Target Start/End: Original strand, 47214488 - 47214655
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
|||||||||| |||| | ||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| ||||||| | |||||||||||| |
|
|
| T |
47214488 |
gaggggtaactttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagtctcttgttt--aaaacagggtaa |
47214585 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
|| ||| |||||||||||| ||||||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
47214586 |
ggttgcgtacaatacacca--aatggtgggaccccttcccagaccctgcatatgcgggagctctagtgcacc |
47214655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 89 - 221
Target Start/End: Original strand, 35005142 - 35005274
Alignment:
| Q |
89 |
actggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccag |
188 |
Q |
| |
|
|||| |||||||||||||||||| | ||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |
|
|
| T |
35005142 |
actgaaaggtcacgggttcaagtcttgaaaacagcctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaaaaatggtgggaccccttcccgg |
35005241 |
T |
 |
| Q |
189 |
accccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||| || |||||||| |||||||||||||||| |
|
|
| T |
35005242 |
accctgcgtatgcgggcgctttagtgcaccggg |
35005274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 47 - 221
Target Start/End: Complemental strand, 45812716 - 45812546
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| | ||||| ||||||||||||||||| |||| |||||||| ||||||||| | ||||| ||||||||||||| | |||||| |
|
|
| T |
45812716 |
gaggggtaaccttggcgcaactgataaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctgaaaacagtctcttgtgtaaaaga--gggtaa |
45812619 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||| ||||||||||||||| |||||||||||| |
|
|
| T |
45812618 |
ggctgcatacaatacaccaa--atggtgggaccccttcccaaaccctgcatatgcgggagctctagtgcaccggg |
45812546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 52 - 221
Target Start/End: Complemental strand, 18742137 - 18741966
Alignment:
| Q |
52 |
gtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagt-gagggaaacaacctcttgtgt-aaaaaacagggtaaggc |
149 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||| |||| ||||||| |||||||| | |||||||| || |||| | ||||||||||||||||| |
|
|
| T |
18742137 |
gtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcaagggttcaaatcttgggaaacagtcttttgtataaaaaaacagggtaaggc |
18742038 |
T |
 |
| Q |
150 |
tgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||| ||||||||||||| ||||||||||||||||||||||||| || |||||| |||||||||||||||||| |
|
|
| T |
18742037 |
tgcgtacaatacaccaaaaatggtgggaccccttcccagaccctgcgtatgcgagagctttagtgcaccggg |
18741966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 44 - 218
Target Start/End: Complemental strand, 19932936 - 19932765
Alignment:
| Q |
44 |
aatgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacaggg |
143 |
Q |
| |
|
|||||||||| ||||||| | ||||||||||||||||||||||| |||| ||||||| |||||||||| ||| ||||||| ||||||||||||||||| |
|
|
| T |
19932936 |
aatgaggggttaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtt--ggatacaacct-ttgtgtaaaaaacaggg |
19932840 |
T |
 |
| Q |
144 |
taaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||| ||||| || ||||| || | |||||||||| |
|
|
| T |
19932839 |
taaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcaagatcattagtgcacc |
19932765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 66 - 219
Target Start/End: Original strand, 6925096 - 6925247
Alignment:
| Q |
66 |
actggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacca |
165 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| ||||| | |||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
6925096 |
actggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaaaatagggtaaggctgcggacaatacacc- |
6925194 |
T |
 |
| Q |
166 |
ataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
219 |
Q |
| |
|
||||||||||||||||||| | ||| || ||||||||||||||||||||||| |
|
|
| T |
6925195 |
-gaatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccg |
6925247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 47 - 221
Target Start/End: Complemental strand, 38478461 - 38478291
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| | |||| ||||| |||||||||||| |||| |||||||||||||||||| |||||| |||||||||| |||||||||||| |
|
|
| T |
38478461 |
gaggggtaaccttggcgcaactagtaaacttgttgtcatgtgactgaaaggtcacgggttcaagtcctagaaacagcctcttgtgt--aaaacagggtaa |
38478364 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||| |||||||||||| |||||||| |||||||| | ||||| ||||||||||||||| |||||||||||| |
|
|
| T |
38478363 |
ggctgcgtacaatacacca--aatggtggaaccccttctcggaccctgcatatgcgggagctctagtgcaccggg |
38478291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 53 - 217
Target Start/End: Complemental strand, 12127010 - 12126850
Alignment:
| Q |
53 |
taaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgc |
152 |
Q |
| |
|
||||||||| | |||| |||||||||||||||||||| || ||||||||||||| |||| ||||||| | |||||||| |||||||||||||||||| |
|
|
| T |
12127010 |
taaccttggcgcaactcgtaaagttgttgtcatgtaattgaaaggtcacgggtttaagttctggaaacagcttcttgtgt--aaaacagggtaaggctgc |
12126913 |
T |
 |
| Q |
153 |
atacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
12126912 |
gtacaatacacca--aattgtgggaccccttcccggaccctgcatatgcgggagctgtagtgcac |
12126850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 69 - 210
Target Start/End: Complemental strand, 18724704 - 18724565
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |||||||||||| | |
|
|
| T |
18724704 |
ggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacacca--a |
18724607 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagcttt |
210 |
Q |
| |
|
|| |||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
18724606 |
atcttgggaccccttcccggaccctacatatgcgggagcttt |
18724565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 52 - 221
Target Start/End: Original strand, 45402077 - 45402245
Alignment:
| Q |
52 |
gtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggt--aagg- |
148 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||| | |||||||| |||||||||||| ||||||| ||||||||||||||| |||||| ||| |
|
|
| T |
45402077 |
gtaaccttggcgcaactggtaaagttgttgtcatgtga-tggaaggtaacgggttcaagtcctggaaacagcctcttgtgtaaaaa-cagggttcaagtt |
45402174 |
T |
 |
| Q |
149 |
ctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
45402175 |
ctgcgtacaatacaccaa--atggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcaccggg |
45402245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 69 - 221
Target Start/End: Complemental strand, 35117927 - 35117774
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
|||||||||||||||| || |||| |||||||||||||||||| ||||| | |||||||||||||| |||||||||||||| ||||||||||||| | |
|
|
| T |
35117927 |
ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaatacagggtaaggctgtgtacaatacaccaaaa |
35117828 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccccgcat-atgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||| |||||||||||||| ||||| || | |||| ||||||||||||||||||| |
|
|
| T |
35117827 |
atgatgggaccccttcccggaccctgcgtaatgcaggagctttagtgcaccggg |
35117774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 41 - 217
Target Start/End: Complemental strand, 41319993 - 41319819
Alignment:
| Q |
41 |
aaaaatgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaaca |
140 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||| |||| |||||||| |||| |||| ||||||| ||||||||||||||||| |
|
|
| T |
41319993 |
aaaattgaggggtaaccttgacacaactggtaaagttgttgtcatgtgactgaaaggtcacaggtttaagtcctggaaacagtctcttgtgtaaaaaaca |
41319894 |
T |
 |
| Q |
141 |
gggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
|||||||||||| |||||||||||| |||| |||||||||||||| |||| |||||||||||| || ||||||| |
|
|
| T |
41319893 |
gggtaaggctgcgtacaatacacca--aatgatgggaccccttcccgaacccttcatatgcgggagtttcagtgcac |
41319819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 51 - 221
Target Start/End: Original strand, 19414420 - 19414586
Alignment:
| Q |
51 |
ggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggct |
150 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| | |||| |||||||||||||||||| |||| | |||||| ||| |||||||| ||||||| |
|
|
| T |
19414420 |
ggtaaccttggcgtaattggtaaagttgttgtcatatgactgaaaggtcacgggttcaagtcctagaaagagcctcttatgt--aaaacaggttaaggct |
19414517 |
T |
 |
| Q |
151 |
gcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|| |||||||||||| ||||||||||||||||||| |||| ||||||||||||||| |||||||||||| |
|
|
| T |
19414518 |
gcgtacaatacacca--aatggtgggaccccttcccgtaccctgcatatgcgggagctctagtgcaccggg |
19414586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 46 - 220
Target Start/End: Original strand, 27474257 - 27474428
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| |||| |||||||| ||||||||| ||||||| ||||||||| |||||||||| | |
|
|
| T |
27474257 |
tgaggggtaaccttagctcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcttggaaacagtctcttgtgt-aaaaacagggca |
27474355 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
| ||||| |||||||||| ||||||||||||||||||| ||||| || |||||||||||||||||||||||| |
|
|
| T |
27474356 |
aagctgcgtacaatacac--tgaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgg |
27474428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 72 - 221
Target Start/End: Original strand, 9939463 - 9939613
Alignment:
| Q |
72 |
aaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatg |
171 |
Q |
| |
|
|||||||||||||||| |||| ||||||||| |||||||| |||||||||||||||| ||| ||||| ||||||| ||| | ||||||||||| |||| |
|
|
| T |
9939463 |
aaagttgttgtcatgtgactgaaaggtcacgagttcaagtcctggaaacaacctcttgtttaagaaacatggtaaggttgcgtgcaatacaccaaaaatg |
9939562 |
T |
 |
| Q |
172 |
gtggga-ccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||| ||||||| | ||||| || ||||||||||||||||||||||||| |
|
|
| T |
9939563 |
gtgggacccccttctcggaccctgcgtatgcgggagctttagtgcaccggg |
9939613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 46 - 221
Target Start/End: Original strand, 8197019 - 8197192
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||| |||| |||||||||||||||||| || || |||||||||||||||||| |||| |
|
|
| T |
8197019 |
tgaggggtaaccttggtgcaactggtcaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggtaattgcctcttgtgtaaaaaacatggta |
8197118 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||| | |||| ||||||| |||||| |||||||||| | ||||| || |||| |||||||||||| |||||| |
|
|
| T |
8197119 |
aggctacgtacagtacacca--aatggtaggaccccttctcggaccctgcgtatgttggagctttagtgtaccggg |
8197192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 70 - 208
Target Start/End: Complemental strand, 25468421 - 25468285
Alignment:
| Q |
70 |
gtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataa |
169 |
Q |
| |
|
|||||||||||||||||| | || ||||||| |||||||||| ||||||||||||||||||||||| |||||||||| ||| |||||||||||| || |
|
|
| T |
25468421 |
gtaaagttgttgtcatgtgattgaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaatcagggtaaggttgcgtacaatacacca--aa |
25468324 |
T |
 |
| Q |
170 |
tggtgggaccccttcccagaccccgcatatgcgggagct |
208 |
Q |
| |
|
|||| ||||| |||||||||||| || |||||||||||| |
|
|
| T |
25468323 |
tggttggacctcttcccagaccctgcgtatgcgggagct |
25468285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 70 - 218
Target Start/End: Original strand, 19701570 - 19701717
Alignment:
| Q |
70 |
gtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataa |
169 |
Q |
| |
|
|||||||||||||| ||| |||| || |||||||||| |||| | | ||||| ||||||||||||||||| ||||||| || ||||||||||||| || |
|
|
| T |
19701570 |
gtaaagttgttgtcgtgtgactgaaatgtcacgggtttaagtcatgaaaacagcctcttgtgtaaaaaacttggtaaggatgggtacaatacaccaa-aa |
19701668 |
T |
 |
| Q |
170 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
||||||| ||||||||| ||||| || |||||||||||||||||||||| |
|
|
| T |
19701669 |
tggtggggccccttcccggaccctgcgtatgcgggagctttagtgcacc |
19701717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 94 - 218
Target Start/End: Complemental strand, 45264534 - 45264411
Alignment:
| Q |
94 |
aaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagacccc |
193 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||| ||||||||| ||||||||| | ||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
45264534 |
aaggtcacatgttcaagtcctggaaacaacctcttgtgcaaaaaacagagtaaggctgtgtgcaatacaccaa-aatggtgggaccccttctcagaccct |
45264436 |
T |
 |
| Q |
194 |
gcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
45264435 |
gcatatgcgggagctttagtgcacc |
45264411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 69 - 220
Target Start/End: Complemental strand, 2435946 - 2435796
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
|||||||||||||||| || |||| |||||||||||||||||| ||||||| |||| ||||| ||||| |||||||| |||| ||||||||||||| | |
|
|
| T |
2435946 |
ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtgaaaaatagggtaagcctgcgtacaatacaccaa-a |
2435848 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
||||||||||||||| || |||| | ||||||||||||||||||||||| |
|
|
| T |
2435847 |
atggtgggacccctttccgtaccctccgcatgcgggagctttagtgcaccgg |
2435796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 84 - 220
Target Start/End: Complemental strand, 35253329 - 35253197
Alignment:
| Q |
84 |
atgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggacccctt |
183 |
Q |
| |
|
|||| |||| ||| |||||||||||||| |||||| |||||||||||||| |||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
35253329 |
atgtgactgaaagatcacgggttcaagtcctcgaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggacccctt |
35253234 |
T |
 |
| Q |
184 |
cccagaccccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
||| ||||| ||||||||||||||| ||||||||||| |
|
|
| T |
35253233 |
cccggaccctgcatatgcgggagctctagtgcaccgg |
35253197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 69 - 221
Target Start/End: Original strand, 35019229 - 35019378
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
|||||||||||||||| | |||| |||||||| | ||||||| | |||||||||||||| |||||| ||| |||||||||||||||||||||||| |
|
|
| T |
35019229 |
ggtaaagttgttgtcacatgactgaaaggtcacagattcaagtcctgtaaacaacctcttgtataaaaatcagtataaggctgcatacaatacaccaat- |
35019327 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||| |||||||||| || |||||| |||||||||||||||||| |
|
|
| T |
35019328 |
-tggtgggacccc-tcccagaccctgcgtatgcgagagctttagtgcaccggg |
35019378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 131 - 221
Target Start/End: Original strand, 4349699 - 4349787
Alignment:
| Q |
131 |
gtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
4349699 |
gtaaaaaacagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggg |
4349787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 69 - 220
Target Start/End: Complemental strand, 27136811 - 27136661
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
|||||||||||||||| || | ||||||| |||| |||||||| || ||||||||||||||||||||||| ||||||| ||| ||||||||||||| | |
|
|
| T |
27136811 |
ggtaaagttgttgtcacgtgattggaaggacacgagttcaagttctgggaacaacctcttgtgtaaaaaacatggtaaggttgcgtacaatacaccaa-a |
27136713 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
||||||||||||||||| ||| | | |||||||||||| |||||||||| |
|
|
| T |
27136712 |
atggtgggaccccttcctagatcatgtgtatgcgggagctccagtgcaccgg |
27136661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 69 - 210
Target Start/End: Original strand, 11596512 - 11596650
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
|||||||| | |||||||| |||| || ||||||||||||||| |||||||||||||||||||||| |||||||||||||| || |||||||||| |
|
|
| T |
11596512 |
ggtaaagtggctgtcatgtgactgaaatgtcacgggttcaagtcctagaaacaacctcttgtgtaaaaa-cagggtaaggctgcgtataatacaccaa-- |
11596608 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagcttt |
210 |
Q |
| |
|
||||||||||||||||| ||||| || |||||||||||||| |
|
|
| T |
11596609 |
atggtgggaccccttcctggaccctgcgtatgcgggagcttt |
11596650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 102 - 218
Target Start/End: Original strand, 22324925 - 22325039
Alignment:
| Q |
102 |
gggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgc |
201 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||| ||||||||||||||||||||||||||||| |||||||| |||| |||| ||||| || ||||| |
|
|
| T |
22324925 |
gggttcaagtcttggaaacagcctcttgtgtaaaa-acagggtaaggctgcatacaatacaccaaaaatggtggagccccgtccc-gaccctgcgtatgc |
22325022 |
T |
 |
| Q |
202 |
gggagctttagtgcacc |
218 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
22325023 |
gggagctttagtgcacc |
22325039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 70 - 221
Target Start/End: Complemental strand, 44485267 - 44485119
Alignment:
| Q |
70 |
gtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataa |
169 |
Q |
| |
|
|||||||||||||||||| | || ||||||||||||| ||| |||||||||| ||||||||||| ||| ||||||||||| |||||||||||| || |
|
|
| T |
44485267 |
gtaaagttgttgtcatgtgattgaaaggtcacgggttatagtcctggaaacaaccacttgtgtaaaagacatggtaaggctgcgtacaatacacca--aa |
44485170 |
T |
 |
| Q |
170 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||| |||||||||||| || || | |||||||||||||| |||||||||| |
|
|
| T |
44485169 |
tggttggaccccttcccggatcctacgtatgcgggagcttt-gtgcaccggg |
44485119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 47 - 185
Target Start/End: Complemental strand, 22930248 - 22930114
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||| |||| ||||||| |||||||||| ||||||| ||| ||||||| |||||||||||| |
|
|
| T |
22930248 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagccttttgtgta-aaaacagggtaa |
22930150 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcc |
185 |
Q |
| |
|
|| || ||||||||||| |||||||||||||||||| |
|
|
| T |
22930149 |
ggttg-tgacaatacacca--aatggtgggaccccttcc |
22930114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 115 - 221
Target Start/End: Original strand, 23796510 - 23796614
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
||||||| ||||||||||||||| || |||||| ||| ||||||||||||| |||||| ||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
23796510 |
ggaaacagcctcttgtgtaaaaatcaatgtaaggttgcgtacaatacaccaa--atggtgagaccccttcccagaccctgcatatgctggagctttagtg |
23796607 |
T |
 |
| Q |
215 |
caccggg |
221 |
Q |
| |
|
||||||| |
|
|
| T |
23796608 |
caccggg |
23796614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 70 - 221
Target Start/End: Complemental strand, 39215117 - 39214967
Alignment:
| Q |
70 |
gtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataa |
169 |
Q |
| |
|
|||||||| |||||| || ||| |||||| | |||||||| ||||||||||||||||||||||||| |||||||||||| ||||||| |||| || |
|
|
| T |
39215117 |
gtaaagttattgtcacgtgactaaaaggtcccaagttcaagtactggaaacaacctcttgtgtaaaaaactgggtaaggctgcgtacaatattccaa-aa |
39215019 |
T |
 |
| Q |
170 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||| |||||||||| |||| || |||| || ||||||||||||||||| |
|
|
| T |
39215018 |
tggtgggtccccttcccaaaccctgcgtatgtggaagctttagtgcaccggg |
39214967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 50 - 200
Target Start/End: Original strand, 25290143 - 25290300
Alignment:
| Q |
50 |
gggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaa--acaacctcttgtgtaaaaaacagggtaag |
147 |
Q |
| |
|
|||||||||||| | ||| ||||||||||||||||||| |||| ||||||||| |||||||| |||| ||| ||||||||||||||||||||||||| |
|
|
| T |
25290143 |
gggtaaccttggcgcaacaggtaaagttgttgtcatgtgactgaaaggtcacgtgttcaagtcttggaaacacagcctcttgtgtaaaaaacagggtaag |
25290242 |
T |
 |
| Q |
148 |
gc-----tgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatg |
200 |
Q |
| |
|
|| || ||||||||||||| |||| | |||||||||||||||| | ||||||| |
|
|
| T |
25290243 |
gcaaggttgtgtacaatacaccaaaaatgataggaccccttcccagactctgcatatg |
25290300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 56 - 185
Target Start/End: Complemental strand, 17470517 - 17470390
Alignment:
| Q |
56 |
ccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcata |
155 |
Q |
| |
|
|||||||| ||| |||||||||||||||| || |||| | ||||| |||||||||| |||||| |||||||||||||||||||||||||||||| || |
|
|
| T |
17470517 |
ccttggtgcaac-ggtaaagttgttgtcacgtgactgaatggtcatgggttcaagtcctagaaacagcctcttgtgtaaaaaacagggtaaggctgcgta |
17470419 |
T |
 |
| Q |
156 |
caatacaccaataatggtgggaccccttcc |
185 |
Q |
| |
|
||||||||||| ||| ||||||||| |||| |
|
|
| T |
17470418 |
caatacaccaa-aatagtgggacccgttcc |
17470390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 68 - 221
Target Start/End: Complemental strand, 15511311 - 15511157
Alignment:
| Q |
68 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgc--atacaatacacca |
165 |
Q |
| |
|
||||||||||||||| |||| ||| |||||||| || |||| |||||| |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
15511311 |
tggtaaagttgttgtaatgtggctgaaaggtcacatattgaagtcctggaaaccgcctcttgtgtaaaaaacagggtaaggctgcggatacaatacacca |
15511212 |
T |
 |
| Q |
166 |
ataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
| |||||||| ||||||||| ||||| || |||| | |||||||||||||||||| |
|
|
| T |
15511211 |
a-aatggtggtaccccttcctggaccctgcgtatgtgtgagctttagtgcaccggg |
15511157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 72 - 176
Target Start/End: Original strand, 22327101 - 22327204
Alignment:
| Q |
72 |
aaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatg |
171 |
Q |
| |
|
|||||||||||||||| |||| |||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| ||| || |||||| |||| |
|
|
| T |
22327101 |
aaagttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgtgtacgatgcaccaa-aatg |
22327199 |
T |
 |
| Q |
172 |
gtggg |
176 |
Q |
| |
|
||||| |
|
|
| T |
22327200 |
gtggg |
22327204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 69 - 181
Target Start/End: Original strand, 33222983 - 33223093
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| || |||| | ||||||| |||||||||| |||||||||| |||| ||| ||||||||||||| | |
|
|
| T |
33222983 |
ggtaaagttgttgtcatgtgactgaaaggtcacggatttaagtcatggaaacagcctcttgtgt-aaaaacagggaaaggttgcgtacaatacaccaa-a |
33223080 |
T |
 |
| Q |
169 |
atggtgggacccc |
181 |
Q |
| |
|
||||||||||||| |
|
|
| T |
33223081 |
atggtgggacccc |
33223093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 67 - 166
Target Start/End: Complemental strand, 4430187 - 4430088
Alignment:
| Q |
67 |
ctggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaa |
166 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |||| | ||||| ||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
4430187 |
ctggtaaagttgttgtcatgtgactggaaggtcacgggtttaagtcttgaaaacagtatcttgtgtaaaaaacagggtaagactgcgtacaatacaccaa |
4430088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 68 - 221
Target Start/End: Complemental strand, 6983969 - 6983820
Alignment:
| Q |
68 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaat |
167 |
Q |
| |
|
||||||||||||||||| || |||| |||||||| ||||||||| ||||||| |||| || |||||||||||||||| ||| |||||||||||| |
|
|
| T |
6983969 |
tggtaaagttgttgtcacgtgactgaaaggtcacaggttcaagtcctggaaacagcctc--gtataaaaaacagggtaagtatgcgtacaatacacca-- |
6983874 |
T |
 |
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||| || ||||| || || || |||||||| |||||||||| |
|
|
| T |
6983873 |
aatggtgggacccctttccggaccctgcgtaggcaggagctttggtgcaccggg |
6983820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 135 - 221
Target Start/End: Complemental strand, 10378828 - 10378744
Alignment:
| Q |
135 |
aaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
10378828 |
aaaacagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcttggaccctgcatatgcgggagctttagtgcaccggg |
10378744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 68 - 221
Target Start/End: Original strand, 20036218 - 20036369
Alignment:
| Q |
68 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaa-aaacagggtaaggctgcatacaatacaccaa |
166 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||| |||||||| |||||||||||| | | |||||||| ||| | |||||||||| |
|
|
| T |
20036218 |
tggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacaaactcttgtgtaaagagaaagggtaagattgcgttcaatacacca- |
20036316 |
T |
 |
| Q |
167 |
taatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||| |||||||||| ||||| || ||||| |||| ||| |||||||||| |
|
|
| T |
20036317 |
-aatggtggaaccccttcccggaccctgcgtatgcaggag-ttttgtgcaccggg |
20036369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 115 - 221
Target Start/End: Complemental strand, 31382326 - 31382223
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
||||||| ||||||||||||||| |||| ||||||||| ||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||| || |
|
|
| T |
31382326 |
ggaaacagcctcttgtgtaaaaa-caggataaggctgcgtacaatacaccaa--atggtgggaccccttcctggaccctgcatatgcgggagctttactg |
31382230 |
T |
 |
| Q |
215 |
caccggg |
221 |
Q |
| |
|
|||||| |
|
|
| T |
31382229 |
taccggg |
31382223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 134 - 220
Target Start/End: Complemental strand, 42304303 - 42304217
Alignment:
| Q |
134 |
aaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
||||||||||||||| ||| |||||||||| || ||||||||||||||||||| ||||| || |||| ||||||||||||||||||| |
|
|
| T |
42304303 |
aaaaacagggtaaggttgcgtacaatacacaaaaaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccgg |
42304217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 136 - 221
Target Start/End: Original strand, 43768205 - 43768288
Alignment:
| Q |
136 |
aaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| || ||| ||||||||||| ||||||||| |
|
|
| T |
43768205 |
aaacagggtaaggctgcctacaatacaccaat--tggtgggaccccttcccagaccctgcgtatacgggagctttaatgcaccggg |
43768288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 156 - 221
Target Start/End: Original strand, 50606487 - 50606552
Alignment:
| Q |
156 |
caatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
50606487 |
caatacaccaaaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggg |
50606552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 123 - 221
Target Start/End: Complemental strand, 1517417 - 1517320
Alignment:
| Q |
123 |
cctcttgtgt-aaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||| |||||||| | ||||||||| |||||||||||||| ||||||||||||||| ||||||| || ||||| ||||||||||||||||||| |
|
|
| T |
1517417 |
cctcttgtgttaaaaaacatgataaggctgcgtacaatacaccaat--tggtgggaccccttctcagaccctgcgtatgcaggagctttagtgcaccggg |
1517320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 115 - 216
Target Start/End: Original strand, 43207540 - 43207640
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| | |||||||||||||||| | |||||||||| |||||||||||| |||||| ||||||||||| |
|
|
| T |
43207540 |
ggaaacaacctcttatgtgaaaaacagggtaagacggcatacaatacaccaa-attggtgggacctcttcccagaccctatgtatgcgagagctttagtg |
43207638 |
T |
 |
| Q |
215 |
ca |
216 |
Q |
| |
|
|| |
|
|
| T |
43207639 |
ca |
43207640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 69 - 217
Target Start/End: Original strand, 50811938 - 50812085
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaa-aacagggtaaggctgcatacaatacaccaat |
167 |
Q |
| |
|
|||||||||||||||| || |||| |||||||||| ||| || ||||||| | |||||||||||| |||||||||||| ||| ||||||||||||| |
|
|
| T |
50811938 |
ggtaaagttgttgtcacgtgactgaaaggtcacggaatcatgtcctggaaacagcttcttgtgtaaaaaaacagggtaaggttgcgtacaatacaccaa- |
50812036 |
T |
 |
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
|||||| |||||||||||| ||| || ||||||||||||||| ||||| |
|
|
| T |
50812037 |
aatggt-ggaccccttcccgcgccctgcgtatgcgggagctttaatgcac |
50812085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 46 - 121
Target Start/End: Original strand, 34714599 - 34714674
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaaca |
121 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||| | || |||||||||||||||||| | ||||||| |
|
|
| T |
34714599 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgattgaaaggtcacgggttcaagtcatggaaaca |
34714674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 48 - 166
Target Start/End: Original strand, 24564322 - 24564440
Alignment:
| Q |
48 |
aggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaag |
147 |
Q |
| |
|
|||||||||||||| | ||| ||||||||| |||| ||| | || |||||| | | ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24564322 |
aggggtaaccttggcgcaaccagtaaagttgatgtcttgtgattgaaaggtcgcagattcaagtcttggaaacaacctcttgtgtaaaaaacagggtaag |
24564421 |
T |
 |
| Q |
148 |
gctgcatacaatacaccaa |
166 |
Q |
| |
|
| ||| |||||| |||||| |
|
|
| T |
24564422 |
ggtgcgtacaattcaccaa |
24564440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 69 - 167
Target Start/End: Complemental strand, 50760385 - 50760287
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaat |
167 |
Q |
| |
|
|||||||| |||||||||| |||| ||||||||||||||||| | ||||| ||||||||||| ||||| |||||||||||| || ||||||||||| |
|
|
| T |
50760385 |
ggtaaagtagttgtcatgtgactgagaggtcacgggttcaagtcctgaaaacagcctcttgtgtataaaactgggtaaggctgcgtataatacaccaat |
50760287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 133 - 221
Target Start/End: Complemental strand, 31442485 - 31442398
Alignment:
| Q |
133 |
aaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||| ||||||||||||||||||| ||| | | |||| ||||||||| |||||||||| |
|
|
| T |
31442485 |
aaaaaacagggtaaggatgcgtacaatacaccaa-aatggtgggaccccttcccggacactgtgtatgtgggagctttggtgcaccggg |
31442398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 56 - 138
Target Start/End: Complemental strand, 2436064 - 2435983
Alignment:
| Q |
56 |
ccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaa |
138 |
Q |
| |
|
|||||||| ||| |||||||||||||||| || |||| |||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
2436064 |
ccttggtgcaac-ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacaacctcctgtgtaaaaaa |
2435983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 49 - 111
Target Start/End: Original strand, 40424721 - 40424783
Alignment:
| Q |
49 |
ggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagt |
111 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||| |||| |||| ||||||||||||| |
|
|
| T |
40424721 |
ggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggccacgggttcaagt |
40424783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 134 - 214
Target Start/End: Original strand, 6358185 - 6358264
Alignment:
| Q |
134 |
aaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
|||| |||||||| ||||| ||||| ||||||| ||||||||||||||||||||||||| || ||||| ||| |||||||| |
|
|
| T |
6358185 |
aaaatcagggtaaagctgcgtacaaaacaccaa-aatggtgggaccccttcccagaccctgcgtatgcaggatctttagtg |
6358264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 126 - 221
Target Start/End: Complemental strand, 20999952 - 20999859
Alignment:
| Q |
126 |
cttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||||||| || |||||||| |||||||||||| |||| |||| |||||||| |||| || || |||||||||||||||||||||| |
|
|
| T |
20999952 |
cttgtgtaaaaaacaaggcaaggctgcgtacaatacacca--aatgatggggccccttccggcaccctgcgtacgcgggagctttagtgcaccggg |
20999859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 170 - 217
Target Start/End: Complemental strand, 33594191 - 33594144
Alignment:
| Q |
170 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
33594191 |
tggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcac |
33594144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 138 - 219
Target Start/End: Original strand, 15505632 - 15505710
Alignment:
| Q |
138 |
acagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
219 |
Q |
| |
|
|||||||||| |||| ||||||||||||| |||||||||||||||||| |||| || |||||||||||||| |||||||| |
|
|
| T |
15505632 |
acagggtaagactgcgtacaatacaccaa--atggtgggaccccttcccgaaccctgcgtatgcgggagcttt-gtgcaccg |
15505710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 115 - 221
Target Start/End: Complemental strand, 19656219 - 19656114
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
||||||| |||||||||||||||||| ||||| ||| ||||||||||||| |||||| |||||| ||| ||||| |||||||| |||||||| || |
|
|
| T |
19656219 |
ggaaacagcctcttgtgtaaaaaacatggtaacgctatgtacaatacaccaa-aatggtaggaccctttcttggaccctgcatatgcaagagctttaatg |
19656121 |
T |
 |
| Q |
215 |
caccggg |
221 |
Q |
| |
|
||||||| |
|
|
| T |
19656120 |
caccggg |
19656114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 117 - 210
Target Start/End: Complemental strand, 20169200 - 20169109
Alignment:
| Q |
117 |
aaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttt |
210 |
Q |
| |
|
||||| |||||||||||||||| | |||||| ||| |||||||| ||||| |||||||| ||||||| ||||| ||||||||||||||||| |
|
|
| T |
20169200 |
aaacaccctcttgtgtaaaaaaaaaggtaagactgtgtacaataccccaatc--ggtgggactccttcccggaccctgcatatgcgggagcttt |
20169109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 168 - 221
Target Start/End: Complemental strand, 4587625 - 4587572
Alignment:
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||||||||||| ||||| || ||||||||||||| ||||||||||| |
|
|
| T |
4587625 |
aatggtgggaccccttcccggaccctgcctatgcgggagcttcagtgcaccggg |
4587572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 89 - 221
Target Start/End: Original strand, 23371143 - 23371271
Alignment:
| Q |
89 |
actggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccag |
188 |
Q |
| |
|
|||| |||||||||||||||||| |||||| || |||| ||||||||| ||| |||| || ||||||||||||| ||| ||||||||||||| || |
|
|
| T |
23371143 |
actgaaaggtcacgggttcaagtcctagaaacagccacttgggtaaaaaac-gggcaaggttgtgtacaatacaccaa--atgctgggaccccttcc-ag |
23371238 |
T |
 |
| Q |
189 |
accccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||| || |||| || ||||||||||||||||| |
|
|
| T |
23371239 |
accctgcgtatgtggtagctttagtgcaccggg |
23371271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 116 - 221
Target Start/End: Complemental strand, 34679331 - 34679224
Alignment:
| Q |
116 |
gaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagac----cccgcatatgcgggagcttta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||| ||||| || |||||||| |||| | |||||| || || ||||||||||||||| |
|
|
| T |
34679331 |
gaaacaacctcttgtgtaaaaaacagggtaagactgcgtactatacatca--aatggtggagccccgttccagacccggcctgcgtatgcgggagcttta |
34679234 |
T |
 |
| Q |
212 |
gtgcaccggg |
221 |
Q |
| |
|
|| ||||||| |
|
|
| T |
34679233 |
gtacaccggg |
34679224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 142 - 218
Target Start/End: Original strand, 7074588 - 7074663
Alignment:
| Q |
142 |
ggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
|||| |||||| ||||||||||||| ||| |||||||| ||| | |||||| |||||| |||||||||||||||||| |
|
|
| T |
7074588 |
ggtatggctgcgtacaatacaccaa-aattgtgggacctctttctagaccctgcatatccgggagctttagtgcacc |
7074663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 115 - 221
Target Start/End: Complemental strand, 34149073 - 34148969
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||||| ||| ||||| | |||| ||||||| |||||||||| ||||| |||||||| ||||| ||||| |
|
|
| T |
34149073 |
ggaaacagcctcttgtgtagaaaatagggtaaggttgcgtacaaaagacca--aatggtgagaccccttcctggaccctgcatatgcaggagcgctagtg |
34148976 |
T |
 |
| Q |
215 |
caccggg |
221 |
Q |
| |
|
|| |||| |
|
|
| T |
34148975 |
caacggg |
34148969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 56 - 218
Target Start/End: Original strand, 52910204 - 52910370
Alignment:
| Q |
56 |
ccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgt-aaaaaacagggtaaggctgcat |
154 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||| |||| |||||||| ||||||| | ||||||| |||||| || ||||||||||||| | ||| | |
|
|
| T |
52910204 |
ccttggtgcaac-ggtaaagttgttgtcatgtgactgaaaggtcacaggttcaactcttggaaacagcctcttaggtaaaaaaacagggtaggactgtgt |
52910302 |
T |
 |
| Q |
155 |
acaatacaccaa----taatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
|||||||||| | | ||||||||||||||||| || || | |||| |||| |||||||||||| |
|
|
| T |
52910303 |
acaatacacctaatggttatggtgggaccccttcctggaacctccgtatgtgggaactttagtgcacc |
52910370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 168 - 221
Target Start/End: Original strand, 30555211 - 30555264
Alignment:
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||||||||| | ||||| || |||||| |||||||||||||||||| |
|
|
| T |
30555211 |
aatggtgggaccccttcacggaccctgcgtatgcgagagctttagtgcaccggg |
30555264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 80 - 157
Target Start/End: Complemental strand, 31272522 - 31272446
Alignment:
| Q |
80 |
tgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcataca |
157 |
Q |
| |
|
||||| || |||| |||||||| ||||||||| ||||||||||||||||||| |||||| ||||||||||| |||| |
|
|
| T |
31272522 |
tgtcacgtgactgaaaggtcacaggttcaagtcctggaaacaacctcttgtgta-aaaacatggtaaggctgcgtaca |
31272446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 89 - 217
Target Start/End: Complemental strand, 19974213 - 19974087
Alignment:
| Q |
89 |
actggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccag |
188 |
Q |
| |
|
|||| ||| |||||||||||||| ||||||| |||| ||||||||| |||| |||| ||| ||||||||||||| |||| |||||||| ||||| | |
|
|
| T |
19974213 |
actgaaagatcacgggttcaagtcttggaaacagcctcaagtgtaaaaat-agggcaaggttgcgtacaatacaccaa-aatgatgggacccattcccgg |
19974116 |
T |
 |
| Q |
189 |
accccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
|| | ||||||||||||||||||||| |
|
|
| T |
19974115 |
actctatgtatgcgggagctttagtgcac |
19974087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 133 - 221
Target Start/End: Original strand, 46859129 - 46859216
Alignment:
| Q |
133 |
aaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||| ||||||||||| | || ||| || || |||| ||||| |||||||||||||| |
|
|
| T |
46859129 |
aaaaaacagggtaagactgcgtacaatacaccaa-aatggtgggactcattttcaggccttgcgtatgtgggagttttagtgcaccggg |
46859216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 168 - 218
Target Start/End: Original strand, 1693222 - 1693273
Alignment:
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagc-tttagtgcacc |
218 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||| ||||| ||||||||||| |
|
|
| T |
1693222 |
aatggtgggaccccttcccagacccggcagatgcaggagcttttagtgcacc |
1693273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 134 - 186
Target Start/End: Complemental strand, 21910743 - 21910693
Alignment:
| Q |
134 |
aaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttccc |
186 |
Q |
| |
|
||||| ||||||||| ||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
21910743 |
aaaaatagggtaaggttgcgtacaatacacca--aatggtgggaccccttccc |
21910693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 116 - 157
Target Start/End: Original strand, 25027989 - 25028030
Alignment:
| Q |
116 |
gaaacaacctcttgtgtaaaaaacagggtaaggctgcataca |
157 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
25027989 |
gaaacagcctcttgtgtaaaaaacgaggtaaggctgcataca |
25028030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 177 - 218
Target Start/End: Complemental strand, 28894611 - 28894570
Alignment:
| Q |
177 |
accccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
||||||||| |||||| ||||||||| ||||||||||||||| |
|
|
| T |
28894611 |
accccttcctagaccctgcatatgcgagagctttagtgcacc |
28894570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 160
Target Start/End: Complemental strand, 18336026 - 18335914
Alignment:
| Q |
48 |
aggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaag |
147 |
Q |
| |
|
|||||||| ||||| | || || ||||||||||| ||||| ||| |||||||| |||||||| | ||| || || |||| |||| ||||||||||| |
|
|
| T |
18336026 |
aggggtaatcttggcgcaagtgataaagttgttgccatgtgtctgaaaggtcacatgttcaagttctgaaaataatctattgtttaaagaacagggtaag |
18335927 |
T |
 |
| Q |
148 |
gctgcatacaata |
160 |
Q |
| |
|
||||| ||||||| |
|
|
| T |
18335926 |
gctgcgtacaata |
18335914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 58)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 47 - 221
Target Start/End: Complemental strand, 7136710 - 7136536
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||| |||||||||||| |||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
7136710 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaaccagggtaa |
7136611 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7136610 |
ggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccggg |
7136536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 46 - 218
Target Start/End: Original strand, 36720749 - 36720919
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
36720749 |
tgaggggtaaccttggcgtaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta |
36720848 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||| ||||| || ||||||| |||||||||||||| |
|
|
| T |
36720849 |
aggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcgtatgcggaagctttagtgcacc |
36720919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 45 - 221
Target Start/End: Original strand, 6760775 - 6760950
Alignment:
| Q |
45 |
atgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggt |
144 |
Q |
| |
|
|||||||||||| |||| | ||||||||||||||||||||| | ||| ||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
6760775 |
atgaggggtaac-ttggcgcaactggtaaagttgttgtcatatgactagaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggt |
6760873 |
T |
 |
| Q |
145 |
aaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
6760874 |
aaggcttcgtacaatacaccaataatggtgggaccccttctcggaccccgcatatgcgggagctttagtgcaccggg |
6760950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 46 - 221
Target Start/End: Complemental strand, 28817808 - 28817635
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
28817808 |
tgaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta |
28817709 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||| ||||| || |||||||||||||||||||| |||| |
|
|
| T |
28817708 |
aggctgcgtacaatacacc--caatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcatcggg |
28817635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 45 - 221
Target Start/End: Complemental strand, 39461179 - 39461003
Alignment:
| Q |
45 |
atgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggt |
144 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||| |||| |||||||||||||||||| ||||||| ||||||||||||||||||| || |
|
|
| T |
39461179 |
atgaggggtaaccttggcgcaactggtaaagttgttgtcatgagactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagagt |
39461080 |
T |
 |
| Q |
145 |
aaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
39461079 |
aaggctgcgtacaatacaccaataatggtgagaccccttcccggaccctgcgtatgcgggagctttagtgcaccggg |
39461003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 47 - 217
Target Start/End: Original strand, 26954086 - 26954257
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaa-aacagggta |
145 |
Q |
| |
|
|||||||||| |||| |||| |||||||||||||||||||| | | ||||||||||||||||||| ||||||| |||||||||||||| ||||||||| |
|
|
| T |
26954086 |
gaggggtaactttggcgtaattggtaaagttgttgtcatgtgattagaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaaacagggta |
26954185 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26954186 |
aggctgcgtacaatacaccaataatggtgggaccccttcccagacctcgcatatgcgggagctttagtgcac |
26954257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 47 - 221
Target Start/End: Original strand, 44530103 - 44530275
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| | |||||||||||||| |||||||| ||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44530103 |
gaggggtaaccttggcgcaactggtaaagttgctgtcatgtgactagaaggtcacgggttcaagtcttggaaacaacctcttgtgtaaaaaacagggtaa |
44530202 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
44530203 |
ggctgcgtacaatacacca--aatggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccggg |
44530275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 47 - 221
Target Start/End: Complemental strand, 12670429 - 12670259
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||||| |||||||||||| |
|
|
| T |
12670429 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaacagggtaa |
12670332 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||| ||||| ||||||||||||||| |||||||||||| |
|
|
| T |
12670331 |
ggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
12670259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 45 - 221
Target Start/End: Original strand, 25250474 - 25250650
Alignment:
| Q |
45 |
atgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggt |
144 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||| |||||||| ||||||| ||| |||||||||||| ||||| |
|
|
| T |
25250474 |
atgagaggtaaccttggcacaactggtaaagttgttgtcatgtgactggaaggtcacatgttcaagtcctggaaacagcctattgtgtaaaaaatagggt |
25250573 |
T |
 |
| Q |
145 |
aaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
| |||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
25250574 |
atggctgcgtacaatacaccaataatggtgggaccccttcccgaaccccgcatatgcgggagatttagtgcaccggg |
25250650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 47 - 221
Target Start/End: Complemental strand, 29521866 - 29521694
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| | ||||| ||||||||||||| ||| ||||||||||||||||||||||| ||||||| |||||||| ||||||||||||||| |
|
|
| T |
29521866 |
gaggggtaaccttggcgcaactgataaagttgttgtcgtgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtttaaaaaacagggtaa |
29521767 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||| |||||||||||| |||||||||| ||| |||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
29521766 |
ggctgcgtacaatacacca--aatggtgggaacccatcccagaccctgcgtatgcgggagctttagtgcaccggg |
29521694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 47 - 221
Target Start/End: Original strand, 35261633 - 35261805
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||| |||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
35261633 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagccctggaaacagtctcttgtgtaaaaaacagggtaa |
35261732 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|| ||| |||||||||||| |||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
35261733 |
ggttgcgtacaatacacca--aatggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccggg |
35261805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 46 - 221
Target Start/End: Complemental strand, 30454277 - 30454106
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||||| |||||| |||| |
|
|
| T |
30454277 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaacaaggta |
30454180 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||| ||| |||||||| ||||||||||||||||||| ||||| ||||||||||||||| |||||||||||| |
|
|
| T |
30454179 |
aggctgcgtacgatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
30454106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 51 - 221
Target Start/End: Complemental strand, 20284250 - 20284078
Alignment:
| Q |
51 |
ggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaaca--gggtaagg |
148 |
Q |
| |
|
|||||||||| | ||| ||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||| ||||||| | |||||||| |
|
|
| T |
20284250 |
ggtaaccttgacgcaacgggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaaaaaagggtaagg |
20284151 |
T |
 |
| Q |
149 |
ctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||| || |||||||||| |||||||||||||| |
|
|
| T |
20284150 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccggg |
20284078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 46 - 221
Target Start/End: Original strand, 13160655 - 13160827
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
||||||||||||| || | ||||||||||||||||||||||| |||| |||||||||||||||||| |||||| |||||||||| |||||||||||| |
|
|
| T |
13160655 |
tgaggggtaacctcggcgcaactggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcctagaaacagcctcttgtgt-aaaaacagggta |
13160753 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||| ||||| || ||||||||||||| ||||| ||||| |
|
|
| T |
13160754 |
aggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcgccggg |
13160827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 45 - 218
Target Start/End: Original strand, 2626471 - 2626645
Alignment:
| Q |
45 |
atgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgt---aaaaaacag |
141 |
Q |
| |
|
||||||||||||||||| | || |||||||||||||||||||| || | |||||||||||||||||| ||||||| |||||||||| ||||||||| |
|
|
| T |
2626471 |
atgaggggtaaccttggcgcaattggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaaaaacag |
2626570 |
T |
 |
| Q |
142 |
ggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
|||||| |||| |||||||||||| |||| |||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
2626571 |
ggtaagactgcgtacaatacacca--aatgatgggaccccttcccagaccctgcatatgcgggagcttcagtgcacc |
2626645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 51 - 221
Target Start/End: Complemental strand, 21070879 - 21070706
Alignment:
| Q |
51 |
ggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaaca---gggtaag |
147 |
Q |
| |
|
|||||||||| | ||| ||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||| ||||||| | ||||||| |
|
|
| T |
21070879 |
ggtaaccttgacgcaacgggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaaaaaaagggtaag |
21070780 |
T |
 |
| Q |
148 |
gctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||||| || |||||||||| |||||||||||||| |
|
|
| T |
21070779 |
gctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccggg |
21070706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 47 - 221
Target Start/End: Original strand, 45071219 - 45071390
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||| | || |||||||||||||||||| ||||||| |||||||||| ||||||||||||| |
|
|
| T |
45071219 |
gaggggtaaccttggcgatactggtaaagttgttgtcatgtgattgtaaggtcacgggttcaagttctggaaacagcctcttgtgt-aaaaacagggtaa |
45071317 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||| |||| || ||||||||||||| ||||||||||| |
|
|
| T |
45071318 |
ggctgcgtacaatacacca--aatggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccggg |
45071390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 69 - 217
Target Start/End: Complemental strand, 44781665 - 44781517
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
|||||||||||||||| || |||| ||| |||||||||||||| |||||||||||||||||||||| |||||||||||||| ||||||||||||| | |
|
|
| T |
44781665 |
ggtaaagttgttgtcacgtgactgaaagttcacgggttcaagtcctggaaacaacctcttgtgtaaaagacagggtaaggctgtgtacaatacaccaaaa |
44781566 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
||| ||||||||| |||||||||| || ||||||||||||||||||||| |
|
|
| T |
44781565 |
atgttgggaccccgtcccagaccctgcgtatgcgggagctttagtgcac |
44781517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 65 - 218
Target Start/End: Complemental strand, 8897927 - 8897776
Alignment:
| Q |
65 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
164 |
Q |
| |
|
||||||||||||||||||||||| || | ||||||||||||| |||| |||||||||| ||||||||||||| ||||||||||| | ||||||||||| |
|
|
| T |
8897927 |
aactggtaaagttgttgtcatgtgacagcaaggtcacgggttgaagtcctggaaacaaccgcttgtgtaaaaaatagggtaaggctacgtacaatacacc |
8897828 |
T |
 |
| Q |
165 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
| ||||||||||||||||||| ||||| |||||||||||||||||| |||||| |
|
|
| T |
8897827 |
a--aatggtgggaccccttcccggaccctgcatatgcgggagctttactgcacc |
8897776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 65 - 221
Target Start/End: Original strand, 12625861 - 12626016
Alignment:
| Q |
65 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgt-aaaaaacagggtaaggctgcatacaatacac |
163 |
Q |
| |
|
||||||||||||||||||| ||| ||| | |||||||||| |||||| |||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
12625861 |
aactggtaaagttgttgtcgtgtgacttgtaggtcacgggctcaagtcctggaaacaacctcttgtgtaaaaaaacagggtaagactgcatacaatacac |
12625960 |
T |
 |
| Q |
164 |
caataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|| |||||||||||||| |||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
12625961 |
ca--aatggtgggaccccctcccggaccctgcgtatgcgggagctttagtgcaccggg |
12626016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 115 - 221
Target Start/End: Original strand, 20869945 - 20870051
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20869945 |
ggaaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttccaggaccccgcatatgcgggagctttagtg |
20870044 |
T |
 |
| Q |
215 |
caccggg |
221 |
Q |
| |
|
||||||| |
|
|
| T |
20870045 |
caccggg |
20870051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 46 - 221
Target Start/End: Original strand, 17823529 - 17823702
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
|||||||||| ||||| | ||||||||||||||||||||||| || | |||||||||||||||||| ||||||| ||||||||||||||| |||| || |
|
|
| T |
17823529 |
tgaggggtaatcttggcgcaactggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaccaggata |
17823628 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|| |||| || ||||||||| |||||||| |||||||||| |||| |||||||| ||||||||||||||||||| |
|
|
| T |
17823629 |
agactgcgtaaaatacacca--aatggtggaaccccttcccgaaccctgcatatgcaggagctttagtgcaccggg |
17823702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 123 - 221
Target Start/End: Original strand, 16225049 - 16225147
Alignment:
| Q |
123 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||| |||||||||||||||||| |||| |||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
16225049 |
cctcttatgtaaaaaacagggtaagactgcgtacaatacaccaataatggtgggatcccttcccggaccccgcatatgcgggagctttagtgcaccggg |
16225147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 47 - 207
Target Start/End: Complemental strand, 20869677 - 20869523
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||| ||||||||| | ||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||||| |||||||||||| |
|
|
| T |
20869677 |
gagggataaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaacagggtaa |
20869580 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagc |
207 |
Q |
| |
|
||||| ||||||||||||| |||| ||||||||||| ||||| |||||||||||||| |
|
|
| T |
20869579 |
ggctgtgtacaatacaccaa----ggtgagaccccttcccggaccctgcatatgcgggagc |
20869523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 97 - 221
Target Start/End: Complemental strand, 8484069 - 8483947
Alignment:
| Q |
97 |
gtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgca |
196 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||| |||||||| |||||||||||||| |||||||||||| |||||||||| || |
|
|
| T |
8484069 |
gtcatgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggcaaggctgcgtacaatacaccaat--tggtgggaccccatcccagaccctgcg |
8483972 |
T |
 |
| Q |
197 |
tatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||| |||||||| |
|
|
| T |
8483971 |
tatgcgggagctttagggcaccggg |
8483947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 46 - 221
Target Start/End: Complemental strand, 18164941 - 18164769
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
|||||||||| ||||| | ||| ||| ||||||||||||||| |||| |||||||||||||||||| ||||||| ||||||||||||||| ||||||| |
|
|
| T |
18164941 |
tgaggggtaatcttggcgcaaccggtgaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaa-cagggta |
18164843 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||| ||| ||||||||||||| | | || |||| ||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
18164842 |
aggttgcgtacaatacaccaa--aggatgtgaccatttcccggaccctgcgtatgcgggagctttagtgcaccggg |
18164769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 48 - 221
Target Start/End: Complemental strand, 44742698 - 44742527
Alignment:
| Q |
48 |
aggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaag |
147 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | || ||||||| | |||||||| |||||||| ||| |||||||||||||||||||| |
|
|
| T |
44742698 |
agggggaaccttggtgcaac-ggtaaagttgttgtcgcgtgattgtaaggtcatgagttcaagttctggaaacaatctcctgtgtaaaaaacagggtaag |
44742600 |
T |
 |
| Q |
148 |
gctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||| ||||| | |||||||||| ||||||||||||| |
|
|
| T |
44742599 |
gctgcgtacaatacaccaa-aatggtgggaccccttcttggaccctacggatgcgggagcattagtgcaccggg |
44742527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 115 - 218
Target Start/End: Original strand, 29877116 - 29877217
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| ||||| || ||||||||||| |||||| |
|
|
| T |
29877116 |
ggaaacagccttttgtgtaaaaaacagggtaaggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcgtatgcgggagcgttagtg |
29877213 |
T |
 |
| Q |
215 |
cacc |
218 |
Q |
| |
|
|||| |
|
|
| T |
29877214 |
cacc |
29877217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 69 - 218
Target Start/End: Original strand, 22598133 - 22598279
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
|||||||||||||||| | |||| |||||||||||||||| | |||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22598133 |
ggtaaagttgttgtcacatgactgaaaggtcacgggttcaaatcctggaaacaacctcttgtgtaaaaaacagggtaaggctatgtacaatacaccaat- |
22598231 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
||||| ||||| ||||| |||| || ||||||||| |||||||||||| |
|
|
| T |
22598232 |
-tggtgagaccctttcccggaccttgcgtatgcggga-ctttagtgcacc |
22598279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 99 - 221
Target Start/End: Complemental strand, 5135418 - 5135299
Alignment:
| Q |
99 |
cacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcata |
198 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||| |||||||||||| |||||||||||| ||||||||||||||||||| ||||| || || |
|
|
| T |
5135418 |
cacgggttcaagtcctggaaacagcctcttgtgtaaaaaagagggtaaggctgtgtacaatacacca--aatggtgggaccccttcccggaccctgcgta |
5135321 |
T |
 |
| Q |
199 |
tgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||| |||||||| |||||||||| |
|
|
| T |
5135320 |
tgcaggagcttt-gtgcaccggg |
5135299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 70 - 219
Target Start/End: Complemental strand, 24365218 - 24365071
Alignment:
| Q |
70 |
gtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaa-cagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
|||||||||||||||||| ||| || |||||||||||||| |||||| |||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
24365218 |
gtaaagttgttgtcatgtgactaaaatgtcacgggttcaagccctagaaacagcctcttgtgtaaaaaatcagggtaaggctgcgaacaatacaccaa-- |
24365121 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
219 |
Q |
| |
|
|||||||||||||||||| ||||| || |||| ||||||||| |||||||| |
|
|
| T |
24365120 |
atggtgggaccccttcccggaccctgcgtatgtgggagcttt-gtgcaccg |
24365071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 48 - 186
Target Start/End: Original strand, 11748254 - 11748392
Alignment:
| Q |
48 |
aggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaag |
147 |
Q |
| |
|
||||||||| |||||| ||||||| || |||||||||||| |||| || ||||||||||||||| ||||||| |||||| |||||||| ||||||||| |
|
|
| T |
11748254 |
aggggtaactttggtgcaactggtgaaattgttgtcatgtgactgaaatgtcacgggttcaagtcttggaaacagcctcttttgtaaaaagcagggtaag |
11748353 |
T |
 |
| Q |
148 |
gctgcatacaatacaccaataatggtgggaccccttccc |
186 |
Q |
| |
|
| || ||||||| || || |||||| |||||||||||| |
|
|
| T |
11748354 |
acagcgtacaatatacaaaaaatggtaggaccccttccc |
11748392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 75 - 220
Target Start/End: Original strand, 31457155 - 31457297
Alignment:
| Q |
75 |
gttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtg |
174 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||| | |||||||||||||||| ||||| ||| |||||||| ||||||||| || |||||| |
|
|
| T |
31457155 |
gttgttgtcatgtggctgaaaggtcacgggttcaagtcctgtaaacaacctcttgtgt-aaaaataggaaaaggctgcgtacaatacatca--aatggta |
31457251 |
T |
 |
| Q |
175 |
ggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
||||||||||||| |||| || |||||||||||| ||||||||||| |
|
|
| T |
31457252 |
ggaccccttcccaaaccctgcgtatgcgggagctctagtgcaccgg |
31457297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 56 - 221
Target Start/End: Original strand, 28407379 - 28407529
Alignment:
| Q |
56 |
ccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcata |
155 |
Q |
| |
|
|||||| | ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
28407379 |
ccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaa-cagggtaaggc------ |
28407471 |
T |
 |
| Q |
156 |
caatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||| |||||||||||||||||| ||||| | ||||||||||||||| ||||||||| |
|
|
| T |
28407472 |
------accaa--atggtgggaccccttcccggaccctacgtatgcgggagctttactgcaccggg |
28407529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 94 - 220
Target Start/End: Original strand, 389644 - 389770
Alignment:
| Q |
94 |
aaggtcacgggttcaagtgagggaaacaacctcttgtgt--aaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagacc |
191 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||| |||||||||||||||| ||| |||||||||||| |||| ||||| ||||| || |||| |
|
|
| T |
389644 |
aaggtcacgggttcaagtcctggaaacaccctcttgtgtcaaaaaaacagggtaaggttgcgtacaatacacca--aatgatgggatccctttcctgacc |
389741 |
T |
 |
| Q |
192 |
ccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
| || |||||| ||||||||||||||||| |
|
|
| T |
389742 |
ctgcgtatgcgagagctttagtgcaccgg |
389770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 123 - 217
Target Start/End: Complemental strand, 17250982 - 17250888
Alignment:
| Q |
123 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
|||||||||||||||||||| |||||| || ||||||||||||||||||||||||||| ||||| |||| || |||| ||||||||||||||| |
|
|
| T |
17250982 |
cctcttgtgtaaaaaacaggttaaggcagcgtacaatacaccaataatggtgggaccctttcccgaaccctgcgtatgaaggagctttagtgcac |
17250888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 72 - 185
Target Start/End: Original strand, 35105902 - 35106014
Alignment:
| Q |
72 |
aaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatg |
171 |
Q |
| |
|
||||||||||||| || ||| |||||||||||||||||| |||||||||||||||||||||| | || |||||||||| ||||||||||| | |||| |
|
|
| T |
35105902 |
aaagttgttgtcacgtggctgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaagagagtgtaaggctgcgtacaatacacc-agaatg |
35106000 |
T |
 |
| Q |
172 |
gtgggaccccttcc |
185 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
35106001 |
gtgggacctcttcc |
35106014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 117 - 190
Target Start/End: Original strand, 43942348 - 43942421
Alignment:
| Q |
117 |
aaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagac |
190 |
Q |
| |
|
||||| |||||| ||| ||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43942348 |
aaacagcctcttatgtcaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccagac |
43942421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 47 - 211
Target Start/End: Original strand, 24245405 - 24245565
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||| |||| |||||||||||||||||| |||||| ||||| ||| |||||||||| |
|
|
| T |
24245405 |
gaggggtaaccttggggcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaac-gtctcttatgt----aacagggtaa |
24245499 |
T |
 |
| Q |
147 |
ggctgcatacaatacacc-aataatggtgggaccccttcccagaccccgcatatgcgggagcttta |
211 |
Q |
| |
|
| || | |||||| |||| || ||| |||||||||||||| ||||| || ||||||||||||||| |
|
|
| T |
24245500 |
gactacgtacaatgcaccaaaaaattgtgggaccccttcctggaccctgcgtatgcgggagcttta |
24245565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 69 - 216
Target Start/End: Complemental strand, 42083858 - 42083712
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
|||||| ||||||||| || |||| |||||||||||||||||| ||||||| ||| |||||||||||| ||| |||||||| |||| || ||||| | |
|
|
| T |
42083858 |
ggtaaaattgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaaaatggggcaaggctgcgtacagtataccaa-a |
42083760 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
216 |
Q |
| |
|
|||||||||||||||||| |||| | || | ||||||||||||||| |
|
|
| T |
42083759 |
atggtgggaccccttcccgaaccctgtgtacgtgggagctttagtgca |
42083712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 123 - 220
Target Start/End: Original strand, 5689661 - 5689756
Alignment:
| Q |
123 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||| |||||||| |||||||||| ||| || |||| ||||||||||||||||||| |
|
|
| T |
5689661 |
cctcttgtgtaaaaagcagggtaaggctgcgtacaatacacca--aatggtggaaccccttcccgaaccatgcgtatgtgggagctttagtgcaccgg |
5689756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 46 - 219
Target Start/End: Complemental strand, 40605087 - 40604917
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
||||||||||| |||| | ||||||||||||||||||||||| | |||| | | | |||||||||| | |||||||| || |||||||||||| || || |
|
|
| T |
40605087 |
tgaggggtaactttggcgcaactggtaaagttgttgtcatgtgattggatgattatgggttcaagtcatggaaacaatcttttgtgtaaaaaattggata |
40604988 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
219 |
Q |
| |
|
||| ||| |||||||||| | |||| | ||| ||||||| | |||| | ||||||||||||||||||||||| |
|
|
| T |
40604987 |
aggttgcgtacaatacacta--aatgat-ggatcccttccgaaaccctacgtatgcgggagctttagtgcaccg |
40604917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 123 - 221
Target Start/End: Original strand, 10857858 - 10857955
Alignment:
| Q |
123 |
cctcttgtgtaaaaaa-cagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||| |||||||||| ||||| |||| || ||||||||||||||||||||||||| |
|
|
| T |
10857858 |
cctcttgtgtaaaaaaacagggtaaggctgcgcacaatacaccaat--tggtgggaccacttcctggaccttgcgtatgcgggagctttagtgcaccggg |
10857955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 154 - 221
Target Start/End: Original strand, 16013515 - 16013582
Alignment:
| Q |
154 |
tacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||| || ||||||| ||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
16013515 |
tacaatacactaaaaatggtgcgaccccttcccagaccctgcctatgcgggagctttagtgcaccggg |
16013582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 135 - 217
Target Start/End: Original strand, 19729382 - 19729462
Alignment:
| Q |
135 |
aaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| |||||| |||||||| |||||||| |
|
|
| T |
19729382 |
aaaacagggtaaggctgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatacgggagctctagtgcac |
19729462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 69 - 209
Target Start/End: Complemental strand, 14018128 - 14017989
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
||||| |||||||||| || | || ||||||| |||||||||| ||||||| ||||||||||||||||||||| || |||| |||||||||| || | |
|
|
| T |
14018128 |
ggtaatgttgttgtcacgtgattgaaaggtcatgggttcaagtcttggaaacagtctcttgtgtaaaaaacagggtgagactgcgtacaatacactaa-a |
14018030 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagctt |
209 |
Q |
| |
|
|||||||||| ||||| ||||| ||| |||||| ||||| |
|
|
| T |
14018029 |
ttggtgggaccacttcctggaccctgcagatgcggtagctt |
14017989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 79 - 186
Target Start/End: Complemental strand, 23000365 - 23000263
Alignment:
| Q |
79 |
ttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggac |
178 |
Q |
| |
|
||||||||| |||| |||||||||||| |||| ||||||| ||||||||||||||| || ||||||| | |||||||||||||| ||||||||||| |
|
|
| T |
23000365 |
ttgtcatgtgactgaaaggtcacgggt--aagtcctggaaacagcctcttgtgtaaaaa-cacggtaaggttccatacaatacacca--aatggtgggac |
23000271 |
T |
 |
| Q |
179 |
cccttccc |
186 |
Q |
| |
|
|||||||| |
|
|
| T |
23000270 |
cccttccc |
23000263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 153 - 221
Target Start/End: Original strand, 26102577 - 26102643
Alignment:
| Q |
153 |
atacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||| || |||||||||||| |||||||||||| |
|
|
| T |
26102577 |
atacaatacaccaa--atggtgggaccccttcccggaccctgcttatgcgggagctctagtgcaccggg |
26102643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 71 - 166
Target Start/End: Original strand, 36918102 - 36918197
Alignment:
| Q |
71 |
taaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaa |
166 |
Q |
| |
|
|||| ||||||| ||| ||||| |||||||| |||||||| |||||||| |||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36918102 |
taaaattgttgttatggaactgaaaggtcacatgttcaagttctggaaacaatttcttatgtaaaaaacagggtaaggctgtgtacaatacaccaa |
36918197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 72 - 152
Target Start/End: Complemental strand, 30962929 - 30962849
Alignment:
| Q |
72 |
aaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgc |
152 |
Q |
| |
|
|||||||||||||||| | || ||||||||| ||||||| ||||||| |||||||||||||||| ||||| ||||||| |
|
|
| T |
30962929 |
aaagttgttgtcatgtgattgaaaggtcacgacttcaagtcctggaaacagcctcttgtgtaaaaaatagggttaggctgc |
30962849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 69 - 182
Target Start/End: Complemental strand, 11001109 - 11000997
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgt-aaaaaacagggtaaggctgcatacaatacaccaat |
167 |
Q |
| |
|
||||||||||||||||||| | || |||||| ||||||||| | | ||||||||| ||||| |||||||| | |||||||| |||||||||||| |
|
|
| T |
11001109 |
ggtaaagttgttgtcatgtgattgaaaggtcgcgggttcaaattctgaaaacaacctactgtgtaaaaaaacaagataaggctgtgtacaatacacca-- |
11001012 |
T |
 |
| Q |
168 |
aatggtgggacccct |
182 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
11001011 |
aatggtgggacccct |
11000997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 26457776 - 26457853
Alignment:
| Q |
140 |
agggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||| || |||| || |||| |||||||||||||||||||| |
|
|
| T |
26457776 |
agggtaaggctgcgtacaatacaccaat--tggtgggacccct--cctgaccttgcgtatgagggagctttagtgcaccggg |
26457853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 170 - 221
Target Start/End: Original strand, 27507985 - 27508036
Alignment:
| Q |
170 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||||||||| |||| || ||||||||||||||||||||||||| |
|
|
| T |
27507985 |
tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccggg |
27508036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 117 - 221
Target Start/End: Original strand, 33866973 - 33867078
Alignment:
| Q |
117 |
aaacaacctcttgtgtaaaaaa-cagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgc |
215 |
Q |
| |
|
||||||| | |||||||||||| ||||||||| |||||||||||||| || ||||||| || |||||| |||| || ||||| | ||||||||||| |
|
|
| T |
33866973 |
aaacaactttttgtgtaaaaaagcagggtaagactgcatacaatacataaaaaatggtgacacttcttcccgaaccctgcgtatgcagaagctttagtgc |
33867072 |
T |
 |
| Q |
216 |
accggg |
221 |
Q |
| |
|
|||||| |
|
|
| T |
33867073 |
accggg |
33867078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 68 - 111
Target Start/End: Complemental strand, 40607884 - 40607841
Alignment:
| Q |
68 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| | |||||||| |
|
|
| T |
40607884 |
tggtaaagttgttgtcatgtaactggaatgtcatgagttcaagt |
40607841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 45 - 87
Target Start/End: Complemental strand, 23286476 - 23286434
Alignment:
| Q |
45 |
atgaggggtaaccttggtgtaactggtaaagttgttgtcatgt |
87 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
23286476 |
atgaggggtaaccttgtcgcaactggtaaagttgttgtcatgt |
23286434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 221
Target Start/End: Complemental strand, 35107373 - 35107320
Alignment:
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||||||||||| ||| | | ||||||| ||||||||||||||||| |
|
|
| T |
35107373 |
aatggtgggaccccttcccggacgctgtgtatgcggaagctttagtgcaccggg |
35107320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 27468141 - 27468101
Alignment:
| Q |
181 |
cttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
27468141 |
cttcccggaccctgcgtatgcgggagctttagtgcaccggg |
27468101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 77)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 47 - 221
Target Start/End: Complemental strand, 13730785 - 13730611
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
13730785 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaa |
13730686 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13730685 |
ggctgtgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccggg |
13730611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 46 - 221
Target Start/End: Complemental strand, 40272994 - 40272821
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||| |||||||||||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40272994 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggta |
40272895 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
40272894 |
aggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggg |
40272821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 47 - 220
Target Start/End: Complemental strand, 46421218 - 46421044
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||| ||| |||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
46421218 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgacttaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaa |
46421119 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttt-agtgcaccgg |
220 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| ||||| || |||||||||||||| |||||||||| |
|
|
| T |
46421118 |
ggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttaagtgcaccgg |
46421044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 45 - 221
Target Start/End: Complemental strand, 13628976 - 13628799
Alignment:
| Q |
45 |
atgaggggtaaccttggtgtaactggtaaa-gttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacaggg |
143 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||||||| |||| |||||||||||||||||| ||||||| |||||||||||| |||||||| |
|
|
| T |
13628976 |
atgaggggtaaccttggcacaactggtaaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaagaaacaggg |
13628877 |
T |
 |
| Q |
144 |
taaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
13628876 |
taaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggg |
13628799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 48 - 217
Target Start/End: Complemental strand, 29366902 - 29366733
Alignment:
| Q |
48 |
aggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaag |
147 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||| |||||||||||||||||| ||||||| |||||||| |||||||||||||||| |
|
|
| T |
29366902 |
aggggtaaccttggcgtaactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaag |
29366803 |
T |
 |
| Q |
148 |
gctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||||| || |||| |||||||||||||||| |
|
|
| T |
29366802 |
gctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcac |
29366733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 45 - 211
Target Start/End: Complemental strand, 8247872 - 8247706
Alignment:
| Q |
45 |
atgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggt |
144 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
8247872 |
atgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggt |
8247773 |
T |
 |
| Q |
145 |
aaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttta |
211 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||| ||||||| ||||| || ||||||||||||||| |
|
|
| T |
8247772 |
aaggttgcgtacaatacaccaataatggtgggactccttcccggaccctgcgtatgcgggagcttta |
8247706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 46 - 213
Target Start/End: Original strand, 9607178 - 9607345
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
|||||||||||||||| | |||| |||||||||||||||||| |||| ||||||| ||||||||| ||||||| ||||||| ||||||||||||||| |
|
|
| T |
9607178 |
tgaggggtaaccttggcgcaacttgtaaagttgttgtcatgtgactgaaaggtcatcggttcaagtcctggaaacagcctcttgcgtaaaaaacagggta |
9607277 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagt |
213 |
Q |
| |
|
||||||| || ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9607278 |
aggctgcgtagaatacaccaataatgttgggaccccttcccagaccccgcatatgcgggagctttagt |
9607345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 45 - 221
Target Start/End: Original strand, 1217064 - 1217236
Alignment:
| Q |
45 |
atgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggt |
144 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||| ||||||| |||| |||||||||||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
1217064 |
atgaggggtaaccttggcgcaactggtaaagttgtagtcatgtcactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaacagggt |
1217161 |
T |
 |
| Q |
145 |
aaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||| |||||||||||| ||||| ||||||||||||| ||||| ||||||||||||||| |||||||||||| |
|
|
| T |
1217162 |
aaggctgcgtacaatacacca--aatggcgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
1217236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 47 - 221
Target Start/End: Complemental strand, 12914216 - 12914044
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||| |||| || | |||||||| |||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
12914216 |
gaggggtaaccttggcgcaactggtaaagttgttgtaatgtgaccgaaaggtcacaagttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaa |
12914117 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||| || |||||||||||| ||||||| ||||||||||||||||| |||||||||||||||| | ||||||||| |
|
|
| T |
12914116 |
ggcggcgtacaatacacca--aatggtgagaccccttcccagaccctgcatatgcgggagcttcaatgcaccggg |
12914044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 115 - 221
Target Start/End: Complemental strand, 49013588 - 49013482
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
49013588 |
ggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatacgcgggagctttagtg |
49013489 |
T |
 |
| Q |
215 |
caccggg |
221 |
Q |
| |
|
||||||| |
|
|
| T |
49013488 |
caccggg |
49013482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 47 - 219
Target Start/End: Complemental strand, 6412002 - 6411833
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||||| |||||| |||||||||| | ||||| ||||||||||| |||||||||||| |
|
|
| T |
6412002 |
gaggggtaaccttgacgcaactggtaaagttgttgtcatgtaactgataggtcatgggttcaagtcttgtaaacagcctcttgtgta-aaaacagggtaa |
6411904 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
219 |
Q |
| |
|
|||||| |||||||||||| |||| ||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
6411903 |
ggctgcgtacaatacacca--aatgatgggaccccttcccagaccttgcgtatgcgggagctttagtgcaccg |
6411833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 46 - 221
Target Start/End: Complemental strand, 5173903 - 5173728
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaa-gttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggt |
144 |
Q |
| |
|
|||||||||||||||| | |||| ||||| ||||||||||||| |||| |||||||||||||||||| ||||||||||||||||||||||| || || |
|
|
| T |
5173903 |
tgaggggtaaccttggcgcaactcgtaaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaa-caaagt |
5173805 |
T |
 |
| Q |
145 |
aaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||| ||||| ||||||||||| ||||||||| ||||||||| |||| || ||||||||||||||||||||||||| |
|
|
| T |
5173804 |
aaggttgcatgcaatacaccaaaaatggtggggccccttcccggaccttgcgtatgcgggagctttagtgcaccggg |
5173728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 46 - 221
Target Start/End: Original strand, 22609742 - 22609913
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
|||||||||||||||| | ||| ||||||||||||||||||| |||| ||||| |||||||||||| ||||||| |||||||||| |||||||||||| |
|
|
| T |
22609742 |
tgaggggtaaccttggcgcaac-ggtaaagttgttgtcatgtgactgtaaggtaacgggttcaagtcttggaaacagcctcttgtgt-aaaaacagggta |
22609839 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||| |||| || ||||||||||||| ||||||||||| |
|
|
| T |
22609840 |
aggctgcgtacaatacacca--aatggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccggg |
22609913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 69 - 221
Target Start/End: Complemental strand, 53996725 - 53996574
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
|||||| |||||||||| | |||| ||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| | |
|
|
| T |
53996725 |
ggtaaatttgttgtcatttgactgaaaggtcacgtgttcaagtcgtggaaacaacctcttgtgtaaaaaacagggtaaggctgcttacaatacaccaa-a |
53996627 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||||| ||| | || |||| |||||||||||||||||||| |
|
|
| T |
53996626 |
atggtgggaccccttccctgacactgcgtatgtgggagctttagtgcaccggg |
53996574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 46 - 221
Target Start/End: Original strand, 39203491 - 39203662
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||| |||| |||||||| ||||||||| |||||| |||||||||||||| ||||||| |
|
|
| T |
39203491 |
tgaggggtaaccttggcacaacttgtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtccttgaaacagcctcttgtgtaaaa--cagggta |
39203588 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||| ||| ||||||||||||| |||||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
39203589 |
aggttgcgtacaatacaccaa--atggtgggaccccttcccggaccttgcatatgcgggagctttagtgcaccggg |
39203662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 129 - 221
Target Start/End: Complemental strand, 353450 - 353358
Alignment:
| Q |
129 |
gtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
353450 |
gtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccggg |
353358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 70 - 217
Target Start/End: Complemental strand, 34420802 - 34420656
Alignment:
| Q |
70 |
gtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataa |
169 |
Q |
| |
|
||||||||||||||| || |||| |||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| ||| ||||||||| || |
|
|
| T |
34420802 |
gtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtaccatacaccaa-aa |
34420704 |
T |
 |
| Q |
170 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
||||||||||||||||| |||| || |||| |||||||||||||||| |
|
|
| T |
34420703 |
tggtgggaccccttcccggaccttgcgtatgtgggagctttagtgcac |
34420656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 82 - 221
Target Start/End: Complemental strand, 45139624 - 45139487
Alignment:
| Q |
82 |
tcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggacccc |
181 |
Q |
| |
|
|||||| |||| |||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45139624 |
tcatgtgactgaaaggtcacgggttcaagttttggaaacaacctcttgtgtaaaacacagggtaaggctgcatacaatacaccaaaaatggtgggacccc |
45139525 |
T |
 |
| Q |
182 |
ttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||| || || ||||||||| |||| |||||||||| |
|
|
| T |
45139524 |
ttcccaga-cctgcgtatgcgggaacttt-gtgcaccggg |
45139487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 115 - 221
Target Start/End: Original strand, 14987001 - 14987107
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |||| ||||||||||||||||||||| |
|
|
| T |
14987001 |
ggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggacccattcccggaccttgcatatgcgggagctttagtg |
14987100 |
T |
 |
| Q |
215 |
caccggg |
221 |
Q |
| |
|
||||||| |
|
|
| T |
14987101 |
caccggg |
14987107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 69 - 218
Target Start/End: Original strand, 26573125 - 26573272
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
|||||||||||||||| || |||| |||||||||||||||||| ||||||| |||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26573125 |
ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtaaaaaacagggtaaggctgcgtacaatacaccaat- |
26573223 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
|||||||||||| |||| ||||| || |||||| ||||||||||||||| |
|
|
| T |
26573224 |
-tggtgggaccccatcccggaccctgcgtatgcgtgagctttagtgcacc |
26573272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 92 - 220
Target Start/End: Complemental strand, 45948974 - 45948848
Alignment:
| Q |
92 |
ggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagacc |
191 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| | |||| |
|
|
| T |
45948974 |
ggaaggtcacgggttcaattcctggaaacaacctcttgtgtaaaaaatagggtaaggctgcatacaatacaccaat--tggtgggaccccttctcggacc |
45948877 |
T |
 |
| Q |
192 |
ccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
| || |||||||||||||||||||||||| |
|
|
| T |
45948876 |
ctgcgtatgcgggagctttagtgcaccgg |
45948848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 51 - 221
Target Start/End: Complemental strand, 22123092 - 22122926
Alignment:
| Q |
51 |
ggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggct |
150 |
Q |
| |
|
||||||||||| | ||||||||| |||||||||||| |||| |||||| ||||||||||| ||||||| ||||||||||||| |||||||||||| |
|
|
| T |
22123092 |
ggtaaccttggcgccactggtaaatttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacagtctcttgtgtaaaa--cagggtaaggct |
22122995 |
T |
 |
| Q |
151 |
gcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|| ||||||||||||| |||||||||||||||||| ||||| ||||||||| ||||| |||||||||||| |
|
|
| T |
22122994 |
gcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgagagctctagtgcaccggg |
22122926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 79 - 221
Target Start/End: Original strand, 516417 - 516560
Alignment:
| Q |
79 |
ttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc-aataatggtggga |
177 |
Q |
| |
|
||||||||| |||| |||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |||||| ||| || ||||| |||| |
|
|
| T |
516417 |
ttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgcacaataaaccaaaaaatggcggga |
516516 |
T |
 |
| Q |
178 |
ccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
516517 |
ccccttccccgaccctgcgtatgcgggagctttagtgcaccggg |
516560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 47 - 221
Target Start/End: Complemental strand, 52926391 - 52926228
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||||||||||| |||| |
|
|
| T |
52926391 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgta---------gtaa |
52926301 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||| |||||||||||| ||||||||||| ||||||| ||||| || |||||||||||||||| |||||||| |
|
|
| T |
52926300 |
ggctgcgtacaatacacca--aatggtgggacaccttcccggaccctgcgtatgcgggagctttagcgcaccggg |
52926228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 65 - 221
Target Start/End: Original strand, 26869701 - 26869854
Alignment:
| Q |
65 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
164 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| ||||||||| ||||||| ||||| |||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
26869701 |
aactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctctggtgt-aaaaacagggtaaggctgcgtacaatacacc |
26869799 |
T |
 |
| Q |
165 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
| |||||||||||||||| || |||| || |||||||||||||| |||||||||| |
|
|
| T |
26869800 |
a--aatggtgggaccccttgccggaccatgcgtatgcgggagctttggtgcaccggg |
26869854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 89 - 218
Target Start/End: Complemental strand, 54374485 - 54374357
Alignment:
| Q |
89 |
actggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccag |
188 |
Q |
| |
|
|||| |||||||| ||||||||| |||||||||||||||||||||||| ||||||||||||| |||||| |||||| ||||||||||||||||||| | |
|
|
| T |
54374485 |
actgaaaggtcacaggttcaagtcttggaaacaacctcttgtgtaaaaaatagggtaaggctgcgtacaatccaccaa-aatggtgggaccccttcccgg |
54374387 |
T |
 |
| Q |
189 |
accccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
|||| |||||||||||||||||||| |||| |
|
|
| T |
54374386 |
accctgcatatgcgggagctttagttcacc |
54374357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 46 - 217
Target Start/End: Original strand, 16735416 - 16735584
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||| |||| || ||||||||||||||| |||||| |||||||| |||||||||||| |
|
|
| T |
16735416 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggta |
16735514 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||| ||| | || ||||||| ||||| ||||||| |
|
|
| T |
16735515 |
aggctgcgtacaatacacca--aatggtgggaccccttcccggacactgcgtatgcggtagcttcagtgcac |
16735584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 42 - 180
Target Start/End: Complemental strand, 4495850 - 4495714
Alignment:
| Q |
42 |
aaaatgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacag |
141 |
Q |
| |
|
|||| ||||||||||||| | | ||||||||||||||||||||||| ||||||||||||||||||||||| | ||| | ||| ||||||||||||||| |
|
|
| T |
4495850 |
aaaaggaggggtaaccttcgcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctgaaaatagcctattgtgtaaaaaacag |
4495751 |
T |
 |
| Q |
142 |
ggtaaggctgcatacaatacaccaataatggtgggaccc |
180 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
4495750 |
ggtaaggctgcgtacaatacacca--aatggtgggaccc |
4495714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 117 - 221
Target Start/End: Complemental strand, 45786327 - 45786223
Alignment:
| Q |
117 |
aaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
216 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| ||||| || |||| |||||||||||||| |
|
|
| T |
45786327 |
aaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgaatgctggagctttagtgca |
45786228 |
T |
 |
| Q |
217 |
ccggg |
221 |
Q |
| |
|
||||| |
|
|
| T |
45786227 |
ccggg |
45786223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 99 - 218
Target Start/End: Complemental strand, 10795554 - 10795435
Alignment:
| Q |
99 |
cacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcata |
198 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||| ||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| || || |
|
|
| T |
10795554 |
cacgggttcaagtcctggaaacagcctcttgtgtaaaagacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcctggaccctgcgta |
10795455 |
T |
 |
| Q |
199 |
tgcgggagctttagtgcacc |
218 |
Q |
| |
|
||||||||||| |||||||| |
|
|
| T |
10795454 |
tgcgggagcttcagtgcacc |
10795435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 46 - 221
Target Start/End: Complemental strand, 7697067 - 7696901
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||| ||| |||||||||||||||||| ||||||| ||||||||| ||||||||||| |
|
|
| T |
7697067 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctggaaacagtctcttgtgt--aaaacagggta |
7696970 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||| |||||||||||| ||||| ||||||||| ||| | ||||||| ||||||| |||||||||||| |
|
|
| T |
7696969 |
aggctgcgtacaatacacca--aatgg-----ccccttcccggacactgcatatgtgggagctctagtgcaccggg |
7696901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 74 - 217
Target Start/End: Original strand, 7942993 - 7943134
Alignment:
| Q |
74 |
agttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggt |
173 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||| ||||||| | |||||| |||||||||||||||| |||| ||||||||| || |||||| |
|
|
| T |
7942993 |
agttgttgtcatgtgactggaaggtcacggattcaagtcctggaaacagcatcttgtctaaaaaacagggtaagactgcgtacaatacatca--aatggt |
7943090 |
T |
 |
| Q |
174 |
gggaccccttcccagaccccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
|||| ||||| ||||||| || ||||||||||||||||||||| |
|
|
| T |
7943091 |
gggatccctttccagaccatgcgtatgcgggagctttagtgcac |
7943134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 82 - 180
Target Start/End: Complemental strand, 54032705 - 54032609
Alignment:
| Q |
82 |
tcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccc |
180 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
54032705 |
tcatgtgactggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc--gaatggtgggaccc |
54032609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 47 - 152
Target Start/End: Complemental strand, 10870132 - 10870028
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| ||||||||||| |||||||||||| |
|
|
| T |
10870132 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgta-aaaacagggtaa |
10870034 |
T |
 |
| Q |
147 |
ggctgc |
152 |
Q |
| |
|
|||||| |
|
|
| T |
10870033 |
ggctgc |
10870028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 70 - 218
Target Start/End: Original strand, 25944468 - 25944615
Alignment:
| Q |
70 |
gtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataa |
169 |
Q |
| |
|
||||||||||||||| || |||| ||||||| |||||||||| |||||| ||||| ||||||||||| ||| ||||||| ||||||||||||| || |
|
|
| T |
25944468 |
gtaaagttgttgtcacgtgactgaaaggtcatgggttcaagtcctggaaaccgcctctcgtgtaaaaaactgggcaaggctgagtacaatacaccaa-aa |
25944566 |
T |
 |
| Q |
170 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
||||||||||||||||| ||||| || |||| ||||||||||| ||||| |
|
|
| T |
25944567 |
tggtgggaccccttccctgaccctgcgtatgtgggagctttagcgcacc |
25944615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 115 - 221
Target Start/End: Original strand, 54484734 - 54484839
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaa-cagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagt |
213 |
Q |
| |
|
||||||| |||||||||||||||| || ||||||||||| ||||||||||||| |||||||||||||||||| ||||| || ||||||||||||||||| |
|
|
| T |
54484734 |
ggaaacagcctcttgtgtaaaaaaacaaggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagt |
54484831 |
T |
 |
| Q |
214 |
gcaccggg |
221 |
Q |
| |
|
|||||||| |
|
|
| T |
54484832 |
gcaccggg |
54484839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 100 - 221
Target Start/End: Original strand, 31592878 - 31592995
Alignment:
| Q |
100 |
acgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatat |
199 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||| |||||||||||||| ||||||||||||| |||||||||| ||||||| ||||| |||||| |
|
|
| T |
31592878 |
acgggttcaagtcctggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggactccttcccggaccctgcatat |
31592973 |
T |
 |
| Q |
200 |
gcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||| |||||||||||| |
|
|
| T |
31592974 |
gcgggagctctagtgcaccggg |
31592995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 48 - 221
Target Start/End: Complemental strand, 25517353 - 25517179
Alignment:
| Q |
48 |
aggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgag--ggaaacaacctcttgtgtaaaaaa-cagggt |
144 |
Q |
| |
|
|||| ||||||||| | ||||||||||||||||||||||| ||||||||||||| || | | | || ||||||| |||||||||||||||| || | | |
|
|
| T |
25517353 |
agggataaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacaggatgatgggacctggaaacatcctcttgtgtaaaaaaacaagat |
25517254 |
T |
 |
| Q |
145 |
aaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
| |||||| |||||||||| || |||||||||||||||||| || || || ||||| ||||||||||||||||||| |
|
|
| T |
25517253 |
atggctgcgtacaatacacaaa--atggtgggaccccttcccggatcctgcgtatgctggagctttagtgcaccggg |
25517179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 73 - 210
Target Start/End: Complemental strand, 30928302 - 30928167
Alignment:
| Q |
73 |
aagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatgg |
172 |
Q |
| |
|
||||| ||||||||| |||| |||||||||||||||||| ||||||| |||||||||||||||||| ||||||| || || ||||||||||| ||| |
|
|
| T |
30928302 |
aagttcttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacaaggtaaggttgtgtaaaatacaccaat--tgg |
30928205 |
T |
 |
| Q |
173 |
tgggaccccttcccagaccccgcatatgcgggagcttt |
210 |
Q |
| |
|
||||||||||||| ||||| ||||||| ||||||||| |
|
|
| T |
30928204 |
cgggaccccttcccggaccctgcatatgtgggagcttt |
30928167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 82 - 214
Target Start/End: Original strand, 33926094 - 33926224
Alignment:
| Q |
82 |
tcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggacccc |
181 |
Q |
| |
|
|||||| |||| ||||||| |||||||||| ||||| | ||||||||||||||| ||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
33926094 |
tcatgtgactgaaaggtcatgggttcaagtcctggaaatagcctcttgtgtaaaaa-cagggtaaggctgtgtacaatacacca-taatggtgggacccc |
33926191 |
T |
 |
| Q |
182 |
ttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
|||| ||||| ||||||||| ||||||||||| |
|
|
| T |
33926192 |
ttcctggaccctgcatatgcgagagctttagtg |
33926224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 44 - 167
Target Start/End: Complemental strand, 45621012 - 45620889
Alignment:
| Q |
44 |
aatgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaa-aaaacagg |
142 |
Q |
| |
|
||||||||| | |||||| | ||| |||||||||||||||| || |||| |||||||||||||||||| ||||||| |||||||||||| |||||||| |
|
|
| T |
45621012 |
aatgagggggagccttggcgcaac-ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagttctggaaacagcctcttgtgtaaaaaaacagg |
45620914 |
T |
 |
| Q |
143 |
gtaaggctgcatacaatacaccaat |
167 |
Q |
| |
|
|||||||||| |||||||||||||| |
|
|
| T |
45620913 |
gtaaggctgcgtacaatacaccaat |
45620889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 135 - 221
Target Start/End: Complemental strand, 34771457 - 34771373
Alignment:
| Q |
135 |
aaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| ||||||||||||||| |||||||||||| |
|
|
| T |
34771457 |
aaaacagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
34771373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 123 - 221
Target Start/End: Original strand, 15797274 - 15797368
Alignment:
| Q |
123 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||| ||||| ||||||| ||||||| |||||||||||| |
|
|
| T |
15797274 |
cctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccggg |
15797368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 69 - 221
Target Start/End: Original strand, 19731000 - 19731150
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
|||||| ||||||||| || | || |||||||||| | ||||| ||||| | |||||||||||||||||| ||||||| ||| ||||||||||| || |
|
|
| T |
19731000 |
ggtaaatttgttgtcacgtgattgaaaggtcacggatgcaagtcctggaaatagcctcttgtgtaaaaaacaaggtaaggttgcgtacaatacacc--ta |
19731097 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||| ||||||||| | | ||||| ||||||||||||||||||| |
|
|
| T |
19731098 |
ttggtgggaccctttcccagactctgtgtatgcaggagctttagtgcaccggg |
19731150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 46 - 218
Target Start/End: Original strand, 12525385 - 12525552
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||| ||| | |||| |||||||| ||||| ||| ||||||| ||||||||||||||| ||||||| |
|
|
| T |
12525385 |
tgaggggtaaccttggcgcaactggtaaagttgt---catatgactgaaaggtcacaggttcgagtcctggaaacagcctcttgtgtaaaaatcagggta |
12525481 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
||||||| | |||||||| ||||||||||| |||||| |||||| | ||| ||||||||| | |||||| |
|
|
| T |
12525482 |
aggctgc--gaagtacaccaaaaatggtgggacaccttcctagaccctgtgtatacgggagcttcactgcacc |
12525552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 116 - 220
Target Start/End: Complemental strand, 829555 - 829452
Alignment:
| Q |
116 |
gaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgc |
215 |
Q |
| |
|
||||||||||||||| |||| |||| |||| | ||| ||||||||||||| ||||||||||||||||||| |||| || ||||| ||||||||||||| |
|
|
| T |
829555 |
gaaacaacctcttgtctaaagaacatagtaaagttgcgtacaatacaccaa-aatggtgggaccccttcccgaaccctgcgtatgcaggagctttagtgc |
829457 |
T |
 |
| Q |
216 |
accgg |
220 |
Q |
| |
|
||||| |
|
|
| T |
829456 |
accgg |
829452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 211
Target Start/End: Original strand, 9276316 - 9276401
Alignment:
| Q |
123 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |||||| |||||| ||||| ||||| || ||||||||| ||||| |
|
|
| T |
9276316 |
cctcttgtgtaaaaaacagggtaaggctgcgtacaatacacca--aatggt-ggaccctttcccggaccctgcgtatgcgggaacttta |
9276401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 117 - 192
Target Start/End: Original strand, 47624088 - 47624160
Alignment:
| Q |
117 |
aaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccc |
192 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| |||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
47624088 |
aaacagcctcttgtgtaaaa-acagggtaaggctgcgtacaatacacca--aatggtgggaccccttcccggaccc |
47624160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 117 - 221
Target Start/End: Original strand, 55401222 - 55401325
Alignment:
| Q |
117 |
aaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
216 |
Q |
| |
|
||||| |||||||||||||||||||| |||| |||| || |||||||||| ||||||||||||||||| | |||| | |||||||||||||| |||| |
|
|
| T |
55401222 |
aaacagcctcttgtgtaaaaaacaggttaagactgcgtataatacaccaa-aatggtgggaccccttctcggaccttccgtatgcgggagcttttttgca |
55401320 |
T |
 |
| Q |
217 |
ccggg |
221 |
Q |
| |
|
||||| |
|
|
| T |
55401321 |
ccggg |
55401325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 168 - 221
Target Start/End: Complemental strand, 24851363 - 24851310
Alignment:
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||||||||||| || || |||||||||||||||||||||||||||| |
|
|
| T |
24851363 |
aatggtgggaccccttcccggatcctgcatatgcgggagctttagtgcaccggg |
24851310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 50 - 163
Target Start/End: Original strand, 21874999 - 21875106
Alignment:
| Q |
50 |
gggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgt-aaaaaacagggtaagg |
148 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||| |||| |||||||||| | |||||||||||||||||| |||||| ||||||||| |
|
|
| T |
21874999 |
gggtaaccttgacgcaactggtaaagttgttgtcatgtgactg-------acgggttcaaattctggaaacaacctcttgtgttaaaaaagagggtaagg |
21875091 |
T |
 |
| Q |
149 |
ctgcatacaatacac |
163 |
Q |
| |
|
|||| |||||||||| |
|
|
| T |
21875092 |
ctgcgtacaatacac |
21875106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 50 - 166
Target Start/End: Original strand, 26782345 - 26782461
Alignment:
| Q |
50 |
gggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggc |
149 |
Q |
| |
|
||||||||||| | || |||||||||| |||||||| | || |||||||||| ||||||| ||||||| ||||||||||||||| ||||||| || |
|
|
| T |
26782345 |
gggtaaccttgacgcaattggtaaagttattgtcatgcgattgaaaggtcacggattcaagtccttgaaacaatctcttgtgtaaaaaatagggtaatgc |
26782444 |
T |
 |
| Q |
150 |
tgcatacaatacaccaa |
166 |
Q |
| |
|
|| ||| |||||||||| |
|
|
| T |
26782445 |
tgtataaaatacaccaa |
26782461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 69 - 145
Target Start/End: Original strand, 53062036 - 53062112
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||| |||||||| ||||||| |||| ||||| |||||||||||| |
|
|
| T |
53062036 |
ggtaaagttgttgtcatgtgactgaaaggtcacgtgttcaagtcctggaaacagcctcctgtgtcaaaaacagggta |
53062112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 77 - 210
Target Start/End: Complemental strand, 8411016 - 8410887
Alignment:
| Q |
77 |
tgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtggg |
176 |
Q |
| |
|
|||||||||| |||| |||||||| |||||| || |||||| |||| |||||||||||||||||||||||| ||||||||||| | ||||||| |
|
|
| T |
8411016 |
tgttgtcatgggactgaaaggtcaccggttcaggtcctggaaactgcctc--gtgtaaaaaacagggtaaggctgctcacaatacacca--actggtggg |
8410921 |
T |
 |
| Q |
177 |
accccttcccagaccccgcatatgcgggagcttt |
210 |
Q |
| |
|
||| |||| ||||||| ||||| |||| |||||| |
|
|
| T |
8410920 |
acctcttctcagaccctgcataggcggaagcttt |
8410887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 170 - 221
Target Start/End: Original strand, 30452892 - 30452943
Alignment:
| Q |
170 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||| |||||||||||| |
|
|
| T |
30452892 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
30452943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 123 - 221
Target Start/End: Complemental strand, 44403661 - 44403564
Alignment:
| Q |
123 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| | ||||| ||| ||||||||||||||||||| ||||| | ||||| | ||||||||||||||||| |
|
|
| T |
44403661 |
cctcttgtgtaaaagacaaggtaaggctgcggagaataccacaa-aatggtgggaccccttcccggaccctacgtatgctgaagctttagtgcaccggg |
44403564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 69 - 221
Target Start/End: Original strand, 19751576 - 19751726
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
|||||| || |||||| || | || |||||||||| | ||||| ||||| | ||||||||||||||| || ||||||| ||| ||||||||||| || |
|
|
| T |
19751576 |
ggtaaattttttgtcacgtgattgaaaggtcacggatgcaagtcctggaaatagcctcttgtgtaaaaatcaaggtaaggttgcgtacaatacacc--ta |
19751673 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||| ||||||||| | ||||| |||||||||||||||||| |
|
|
| T |
19751674 |
ttggtgggaccctttcccagactttgtgtatgcatgagctttagtgcaccggg |
19751726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 115 - 218
Target Start/End: Complemental strand, 31904970 - 31904868
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtggga-ccccttcccagaccccgcatatgcgggagctttagt |
213 |
Q |
| |
|
||||||| ||| || |||||||||||||||| | |||| |||||||||||| |||||||||| |||||||||||| | | | ||||||||||||||| |
|
|
| T |
31904970 |
ggaaacagcctattatgtaaaaaacagggtatgactgcgtacaatacacca--aatggtgggacccccttcccagatcttacgtgtgcgggagctttagt |
31904873 |
T |
 |
| Q |
214 |
gcacc |
218 |
Q |
| |
|
||||| |
|
|
| T |
31904872 |
gcacc |
31904868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 168 - 221
Target Start/End: Original strand, 35417999 - 35418052
Alignment:
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||| ||||||||||||| |||| |
|
|
| T |
35417999 |
aatggtgggaccccttcccggaccccgcaaatgcgagagctttagtgcatcggg |
35418052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 73 - 162
Target Start/End: Original strand, 39211992 - 39212081
Alignment:
| Q |
73 |
aagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaataca |
162 |
Q |
| |
|
||||||| || |||| |||| || ||||||||||||||| ||||| ||||||||||||||| |||| |||||| |||| ||||||||| |
|
|
| T |
39211992 |
aagttgtcgttatgtgactgaaatgtcacgggttcaagtcctggaaataacctcttgtgtaaataacaaggtaagactgcgtacaataca |
39212081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 115 - 216
Target Start/End: Complemental strand, 43114983 - 43114882
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaa-cagggtaagg-ctgcatacaatacaccaataatggtgggaccccttcccagacccc-gcatatgcgggagcttta |
211 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||| || | ||||||||||||| |||||||||||| |||| |||||| || ||||||||||||||| |
|
|
| T |
43114983 |
ggaaacagcctcttgtgtaaaaaaacagggtaagggctacctacaatacaccaa--atggtgggaccc-ttcctggacccctgcgtatgcgggagcttta |
43114887 |
T |
 |
| Q |
212 |
gtgca |
216 |
Q |
| |
|
||||| |
|
|
| T |
43114886 |
gtgca |
43114882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 79 - 166
Target Start/End: Complemental strand, 52428627 - 52428539
Alignment:
| Q |
79 |
ttgtcatgtaactggaaggtcacgggttcaagtgag-ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaa |
166 |
Q |
| |
|
|||||| ||| ||| ||||||||||||| |||| |||| || |||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
52428627 |
ttgtcacgtagctgaaaggtcacgggtttaagtctctggaagcagcctcttgtgtaaaatacagggtaaggctgcgtacaatacaccaa |
52428539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 54 - 218
Target Start/End: Original strand, 33235513 - 33235676
Alignment:
| Q |
54 |
aaccttggtgtaactggtaaagttgttgtcatgtaac-tggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaa-aacagggtaaggctg |
151 |
Q |
| |
|
||||||| || | ||||||||||||||||||||| || || |||||||| |||||| | | ||| | |||||||||||||| ||||||||||| ||| |
|
|
| T |
33235513 |
aaccttgatgcagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaagagcctcttgtgtaaaaaaacagggtaagactg |
33235612 |
T |
 |
| Q |
152 |
catacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
|||||||||| | |||||||||||||| || |||||| | ||||||| |||||||||||||| |
|
|
| T |
33235613 |
tgtacaatacacta--aatggtgggacccc-tcgcagaccttacgtatgcggaagctttagtgcacc |
33235676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 69 - 143
Target Start/End: Original strand, 35417914 - 35417988
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacaggg |
143 |
Q |
| |
|
|||||||||||| |||||| |||| |||||||| |||||| | ||||||| ||||||||||||||||||||| |
|
|
| T |
35417914 |
ggtaaagttgttatcatgtgactgagaggtcacgagttcaaatcctggaaacagcctcttgtgtaaaaaacaggg |
35417988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 116 - 221
Target Start/End: Complemental strand, 50625065 - 50624962
Alignment:
| Q |
116 |
gaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgc |
215 |
Q |
| |
|
|||||| ||||||||||| |||| ||||||||| || |||||||||||| | ||||||||| |||||| | ||| || || | |||||||||||||| |
|
|
| T |
50625065 |
gaaacagcctcttgtgtataaaaaagggtaaggtagcgtacaatacaccatt--tggtgggacgccttcctgggccctgcgtaagtgggagctttagtgc |
50624968 |
T |
 |
| Q |
216 |
accggg |
221 |
Q |
| |
|
|||||| |
|
|
| T |
50624967 |
accggg |
50624962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 220
Target Start/End: Original strand, 24577930 - 24577982
Alignment:
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
|||||||||| || ||||||||||| |||||| |||||||| ||||||||||| |
|
|
| T |
24577930 |
aatggtgggatcctttcccagaccctgcatatacgggagctctagtgcaccgg |
24577982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 123 - 221
Target Start/End: Original strand, 26292384 - 26292478
Alignment:
| Q |
123 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||| ||||||||| | || ||| ||||||||| ||| ||||| |||||||| |||| |||||||||||| || |||||||||||| |
|
|
| T |
26292384 |
cctcttgtgtaaaa--cagggtaagaccgcgtacgatacaccaa--atgatgggatcccttcccgaaccctgcatatgcgggaactctagtgcaccggg |
26292478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 115 - 166
Target Start/End: Original strand, 31831243 - 31831292
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaa |
166 |
Q |
| |
|
||||||| |||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
31831243 |
ggaaacagcctcttgtgtaaaata--gggtaaggctgcatacaatacaccaa |
31831292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 216
Target Start/End: Original strand, 40968613 - 40968661
Alignment:
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
216 |
Q |
| |
|
||||||| |||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
40968613 |
aatggtgagaccccttcctagaccctacatatgcgggagctttagtgca |
40968661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 10484671 - 10484625
Alignment:
| Q |
175 |
ggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
10484671 |
ggaccccttcctggaccctgcgtatgcgggagctttagtgcaccggg |
10484625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 45 - 86
Target Start/End: Original strand, 9276248 - 9276289
Alignment:
| Q |
45 |
atgaggggtaaccttggtgtaactggtaaagttgttgtcatg |
86 |
Q |
| |
|
||||||||||||||||| | |||| ||||||||||||||||| |
|
|
| T |
9276248 |
atgaggggtaaccttggcgcaactagtaaagttgttgtcatg |
9276289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 221
Target Start/End: Original strand, 24578020 - 24578073
Alignment:
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||| | ||||||||||| ||||||||||| || |||||||||||| |
|
|
| T |
24578020 |
aatggtgggactctttcccagaccctacatatgcgggaactctagtgcaccggg |
24578073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 77 - 166
Target Start/End: Original strand, 29106555 - 29106644
Alignment:
| Q |
77 |
tgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaa |
166 |
Q |
| |
|
||||||||||| || ||| |||||||| ||||| | |||||||||||||||||||||| ||| ||||| | | ||||||||||||| |
|
|
| T |
29106555 |
tgttgtcatgtggctcaaagatcacgggtacaagtcttgaaaacaacctcttgtgtaaaaaataggataaggttacgtacaatacaccaa |
29106644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 111
Target Start/End: Original strand, 4537003 - 4537071
Alignment:
| Q |
43 |
aaatgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagt |
111 |
Q |
| |
|
||||||||||||||||||| ||| ||||| ||||| ||||||| | || ||||||||||||| |||| |
|
|
| T |
4537003 |
aaatgaggggtaaccttggcataatcggtaatgttgtggtcatgtgattgaaaggtcacgggtttaagt |
4537071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 180
Target Start/End: Original strand, 16130312 - 16130383
Alignment:
| Q |
108 |
aagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccc |
180 |
Q |
| |
|
|||||| | ||||| | |||| |||||||| |||| ||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
16130312 |
aagtgatgaaaacatcgtcttctgtaaaaagcaggataaggctgcgaacaatacaccaa-aatggtgggaccc |
16130383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 70 - 178
Target Start/End: Original strand, 32418221 - 32418329
Alignment:
| Q |
70 |
gtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataa |
169 |
Q |
| |
|
||||||||||||||| || |||| || |||| ||| |||| | ||||||||||||| |||||| |||| |||| |||||||||||| || || || |
|
|
| T |
32418221 |
gtaaagttgttgtcaagtgactgaaatgtcattagtttaagtcatagaaacaacctcttacataaaaatcaggataagactgcatacaataaacaaaaaa |
32418320 |
T |
 |
| Q |
170 |
tggtgggac |
178 |
Q |
| |
|
||||||||| |
|
|
| T |
32418321 |
tggtgggac |
32418329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 216
Target Start/End: Complemental strand, 46170029 - 46169981
Alignment:
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
216 |
Q |
| |
|
|||||| |||||||||||| ||||| ||||||| |||||||| |||||| |
|
|
| T |
46170029 |
aatggtaggaccccttcccggaccctgcatatgtgggagcttcagtgca |
46169981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 128; Significance: 2e-66; HSPs: 66)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 50 - 221
Target Start/End: Complemental strand, 4619284 - 4619113
Alignment:
| Q |
50 |
gggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggc |
149 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||| ||||||||||||||||||||||| ||||| | ||||||||||||||||||||||||||| |
|
|
| T |
4619284 |
gggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaaaacagggtaaggc |
4619185 |
T |
 |
| Q |
150 |
tgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
4619184 |
tgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgagagctttagtgcaccggg |
4619113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 46 - 221
Target Start/End: Original strand, 38879534 - 38879709
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
38879534 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggta |
38879633 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
38879634 |
aggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggg |
38879709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 42 - 221
Target Start/End: Original strand, 41014268 - 41014444
Alignment:
| Q |
42 |
aaaatgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacag |
141 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |||||||||| |||||||| |
|
|
| T |
41014268 |
aaaatgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgt-aaaaacag |
41014366 |
T |
 |
| Q |
142 |
ggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
41014367 |
ggtaaggctgcgtacaatacacca--aatggtgggaccccttcctggaccccgcatatgcgggagctttagtgcaccggg |
41014444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 47 - 221
Target Start/End: Original strand, 24448844 - 24449016
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||| |||||||||||| ||||||| |
|
|
| T |
24448844 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaaaatagggtaa |
24448943 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||| ||||| || ||||| ||||||||||||||||||| |
|
|
| T |
24448944 |
ggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccggg |
24449016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 50 - 221
Target Start/End: Original strand, 43334159 - 43334330
Alignment:
| Q |
50 |
gggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgt-aaaaaacagggtaagg |
148 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||| ||||| |||||||||||||||| |
|
|
| T |
43334159 |
gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtaaaaaaacagggtaagg |
43334258 |
T |
 |
| Q |
149 |
ctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||| ||||| || |||||||||||||||||||||||| |
|
|
| T |
43334259 |
ctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgc-gatgcgggagctttagtgcaccggg |
43334330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 73 - 219
Target Start/End: Complemental strand, 12006485 - 12006339
Alignment:
| Q |
73 |
aagttgttgtcatgtaactggaaggtcacggg-ttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatg |
171 |
Q |
| |
|
||||||||||||||| |||| ||||||||||| ||||||| || |||||||||||| ||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
12006485 |
aagttgttgtcatgtgactgaaaggtcacggggttcaagtctgg-aaacaacctcttatgtaaaaaatagggtaaggctccatacaatacaccaataatg |
12006387 |
T |
 |
| Q |
172 |
gtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
219 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
12006386 |
gtgggaccccttcccagaccctgcctatgcgggagctttagtgcaccg |
12006339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 50 - 216
Target Start/End: Original strand, 27328709 - 27328875
Alignment:
| Q |
50 |
gggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggc |
149 |
Q |
| |
|
||||||||||| | || |||||||||||||||||||| |||| |||||||| ||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
27328709 |
gggtaaccttgacgcaattggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagtctcttgtgtaaaaaacagggtaaggc |
27328808 |
T |
 |
| Q |
150 |
tgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
216 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||| |||| || ||||||||||||||| |||| |
|
|
| T |
27328809 |
tgcgtacaatacaccaataatggtgggaccccttcccgaaccctgcgtatgcgggagctttaatgca |
27328875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 47 - 221
Target Start/End: Original strand, 35710267 - 35710437
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |||||||||| |||| ||||||| |
|
|
| T |
35710267 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtaactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaatagggtaa |
35710364 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||| | |||||||||| ||||||||||||||||||| || | ||||||||||||||| |||||||||||| |
|
|
| T |
35710365 |
ggctgcgttcaatacacca--aatggtgggaccccttcccggaacatgcatatgcgggagctctagtgcaccggg |
35710437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 47 - 221
Target Start/End: Complemental strand, 8170163 - 8169993
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||| ||||||||| | ||||||||||||||||||||||| || | |||||||||||||||||| ||||||| ||| |||||| |||||||||||| |
|
|
| T |
8170163 |
gagggctaaccttggcgcaactggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagccttttgtgt--aaaacagggtaa |
8170066 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||| ||||| ||||||||||||| || ||||||||||| |
|
|
| T |
8170065 |
ggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagtttcagtgcaccggg |
8169993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 102 - 221
Target Start/End: Complemental strand, 13801895 - 13801776
Alignment:
| Q |
102 |
gggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgc |
201 |
Q |
| |
|
|||||||||| |||| || |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13801895 |
gggttcaagtcctggaagcagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgc |
13801796 |
T |
 |
| Q |
202 |
gggagctttagtgcaccggg |
221 |
Q |
| |
|
| |||||||||||||||||| |
|
|
| T |
13801795 |
gagagctttagtgcaccggg |
13801776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 115 - 221
Target Start/End: Original strand, 20135626 - 20135732
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |||| |
|
|
| T |
20135626 |
ggaaacagcctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcaggagcttcagtg |
20135725 |
T |
 |
| Q |
215 |
caccggg |
221 |
Q |
| |
|
||||||| |
|
|
| T |
20135726 |
caccggg |
20135732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 80 - 221
Target Start/End: Original strand, 32703411 - 32703548
Alignment:
| Q |
80 |
tgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggacc |
179 |
Q |
| |
|
|||||||| |||| |||||||||||||||||| ||||||| |||||||||||||| |||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
32703411 |
tgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggacc |
32703506 |
T |
 |
| Q |
180 |
ccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||| ||||| ||||||||||||||| |||||||||||| |
|
|
| T |
32703507 |
ccttcccggaccctgcatatgcgggagctctagtgcaccggg |
32703548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 46 - 210
Target Start/End: Original strand, 22600407 - 22600569
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||||| |||||||||| |||||||||||| |||||||| | |||||||||| |||||||| |
|
|
| T |
22600407 |
tgaggggtaaccttgacgtaactggtaaagttgttatcatgtgactggaaggttacgggttcaagtcctggaaacaatattttgtgtaaaacacagggta |
22600506 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttt |
210 |
Q |
| |
|
|||||| |||||||||||| |||||||||| |||||||| || || || |||||||||||||| |
|
|
| T |
22600507 |
aggctgtgtacaatacacca--aatggtgggatcccttcccggatcctgcgtatgcgggagcttt |
22600569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 47 - 221
Target Start/End: Original strand, 1565385 - 1565557
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgt-aaaaaacagggta |
145 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||| |||| |||||| ||||||||||| ||||||||||||||| || |||||||| || |
|
|
| T |
1565385 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacaacctcttgagtaaaaaaacatatta |
1565484 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||| |||||| ||||| ||||| ||||||||||||| ||||| ||||||| |||||| ||||||||||||| |
|
|
| T |
1565485 |
aggctgcgtacaatgcacca--aatggcgggaccccttcccggaccctgcatatgtgggagc-ttagtgcaccggg |
1565557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 46 - 152
Target Start/End: Original strand, 23974734 - 23974839
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
|||||||||||||||| | ||| ||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
23974734 |
tgaggggtaaccttggcgcaac-ggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaagagggta |
23974832 |
T |
 |
| Q |
146 |
aggctgc |
152 |
Q |
| |
|
||||||| |
|
|
| T |
23974833 |
aggctgc |
23974839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 69 - 214
Target Start/End: Complemental strand, 28516593 - 28516449
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
|||||||||||||||| || ||| |||||||||||||||||| ||||||| |||||||||||||||||||| || |||||| ||||||||| ||| | |
|
|
| T |
28516593 |
ggtaaagttgttgtcaggtggctgaaaggtcacgggttcaagtcttggaaacatcctcttgtgtaaaaaacaggctagggctgcgtacaatacatcaa-a |
28516495 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
|||||||||||| ||||||||||| || |||| |||||||||||| |
|
|
| T |
28516494 |
atggtgggacccattcccagaccctgcgcatgcaggagctttagtg |
28516449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 46 - 158
Target Start/End: Complemental strand, 37024736 - 37024626
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||||| ||||||||||| |
|
|
| T |
37024736 |
tgaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaacagggta |
37024639 |
T |
 |
| Q |
146 |
aggctgcatacaa |
158 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
37024638 |
aggctgcgtacaa |
37024626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 69 - 221
Target Start/End: Complemental strand, 209086 - 208936
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
||||||||||||||||||| ||| |||||||| |||||||| || |||||||||||||||| |||||||||||||||||||| ||||||||||| | |
|
|
| T |
209086 |
ggtaaagttgttgtcatgtgactaaaaggtcacaagttcaagtcctggcaacaacctcttgtgta-aaaacagggtaaggctgcattcaatacaccaa-a |
208989 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||||||||| ||||| | ||||| |||||||||||||||||| |
|
|
| T |
208988 |
atggtgggaccccttcctggaccctgggtatgcaagagctttagtgcaccggg |
208936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 69 - 221
Target Start/End: Original strand, 39301099 - 39301249
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||| || |||||||||||||||| |||||||||||||| ||| || ||| |||||| | |
|
|
| T |
39301099 |
ggtaaagttgttgtcatgttactgaaaggtcacgggttcaagtcttgggaacaacctcttgtgtataaaacagggtaaggatgcgtataatgcaccaa-a |
39301197 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
| |||||||||||||||| ||||| | |||| ||||| |||||||||||||| |
|
|
| T |
39301198 |
aaggtgggaccccttcccggaccctccgtatgtgggag-tttagtgcaccggg |
39301249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 46 - 216
Target Start/End: Original strand, 22187238 - 22187408
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
||||||||||| |||| | |||| |||||||||||||||| | |||| |||||||| |||| |||| ||||||| |||||||||||||||||| | || |
|
|
| T |
22187238 |
tgaggggtaactttggcgcaactagtaaagttgttgtcatttgactgaaaggtcaccggtttaagtcctggaaacagcctcttgtgtaaaaaacatgata |
22187337 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
216 |
Q |
| |
|
|| |||| ||||||||||||| || || |||||||||||| |||| ||||||| |||||||||||||| |
|
|
| T |
22187338 |
agactgcgtacaatacaccaaaaacaatgagaccccttcccaaaccctacatatgcaggagctttagtgca |
22187408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 96 - 221
Target Start/End: Original strand, 43574609 - 43574732
Alignment:
| Q |
96 |
ggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgc |
195 |
Q |
| |
|
||||||| |||||||| |||||||| |||||||||| |||||||||||||||||| ||||||| |||| ||||||||||||||||||| ||||| || |
|
|
| T |
43574609 |
ggtcacgtgttcaagtcctggaaacaatctcttgtgtagaaaacagggtaaggctgcgtacaatatacca--aatggtgggaccccttcccggaccctgc |
43574706 |
T |
 |
| Q |
196 |
atatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||| |||||||| |
|
|
| T |
43574707 |
gtatgcgggagctttagagcaccggg |
43574732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 97 - 190
Target Start/End: Original strand, 41425952 - 41426043
Alignment:
| Q |
97 |
gtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagac |
190 |
Q |
| |
|
||||||||||||||| ||||||||| | ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41425952 |
gtcacgggttcaagttctggaaacaacttattgtgtaaaaaacagggtaaggctgcatacaatacaccaat--tggtgggaccccttcccagac |
41426043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 115 - 221
Target Start/End: Original strand, 7368420 - 7368522
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||| |||||||||||||| ||||||||||||||||| ||||| ||||||| ||||||| ||||| |
|
|
| T |
7368420 |
ggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaat--tggtgggaccccttcccggaccctgcatatgtgggagctctagtg |
7368515 |
T |
 |
| Q |
215 |
caccggg |
221 |
Q |
| |
|
||||||| |
|
|
| T |
7368516 |
caccggg |
7368522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 118 - 221
Target Start/End: Complemental strand, 16880757 - 16880656
Alignment:
| Q |
118 |
aacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||| ||||||| |||| |||||| |||| || ||||||||||||||||||||| |
|
|
| T |
16880757 |
aacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacacca--aatggtgtgaccacttcccggaccatgcgtatgcgggagctttagtgcac |
16880660 |
T |
 |
| Q |
218 |
cggg |
221 |
Q |
| |
|
|||| |
|
|
| T |
16880659 |
cggg |
16880656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 68 - 217
Target Start/End: Complemental strand, 19143102 - 19142956
Alignment:
| Q |
68 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaat |
167 |
Q |
| |
|
||||||| ||||||||| || ||| || | ||| ||||||||| ||||||||||||||||||||||| |||||||||||||| |||| |||||||| |
|
|
| T |
19143102 |
tggtaaaattgttgtcacgtgactaaaatgccacaggttcaagtcctggaaacaacctcttgtgtaaaaa-cagggtaaggctgcgtacagtacaccaa- |
19143005 |
T |
 |
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
|||||||||||||||||| |||| || |||||||||| |||||||||| |
|
|
| T |
19143004 |
-atggtgggaccccttcccggaccatgcgtatgcgggagatttagtgcac |
19142956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 89 - 220
Target Start/End: Complemental strand, 42924973 - 42924840
Alignment:
| Q |
89 |
actggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccag |
188 |
Q |
| |
|
|||| ||||||||| |||||||| | ||||||| |||||||||||||||||||||||| ||| ||||||||||||| |||| ||| | |||||||||| |
|
|
| T |
42924973 |
actgaaaggtcacgagttcaagtcctgaaaacaacatcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaaaaatgatggaatcccttcccag |
42924874 |
T |
 |
| Q |
189 |
--accccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
|||| || ||||||| |||||||||||||||| |
|
|
| T |
42924873 |
acaccctgcgtatgcggaagctttagtgcaccgg |
42924840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 76 - 220
Target Start/End: Original strand, 1405170 - 1405312
Alignment:
| Q |
76 |
ttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgg |
175 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||| |||||||||||||| | ||||||| || ||||| ||| |||||||||||| |||||||| |
|
|
| T |
1405170 |
ttgttgtcatgtgactagaaggtcacgggttcaagtcctggaaacaacctcttatataaaaaatagagtaagtttgcgtacaatacacca--aatggtgg |
1405267 |
T |
 |
| Q |
176 |
gaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
||||| |||| |||| ||||||||||||||| |||| |||||| |
|
|
| T |
1405268 |
gaccctttcctgaaccctgcatatgcgggagctctagtacaccgg |
1405312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 48 - 207
Target Start/End: Original strand, 2838733 - 2838890
Alignment:
| Q |
48 |
aggggtaaccttggtgtaactggtaaagttgttgtcatgtaactg-gaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
|||||||||||||| | ||| ||||||||||||||||||| |||| ||||||||| | |||||| |||||| | |||||||| ||||||||||||| |
|
|
| T |
2838733 |
aggggtaaccttggcgcaaccggtaaagttgttgtcatgtgactgtaaaggtcacgaggtcaagtctcagaaacagcatcttgtgt-aaaaacagggtaa |
2838831 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagc |
207 |
Q |
| |
|
|||||| |||||||||||| |||||||||| |||||| | ||||| || ||||||||||| |
|
|
| T |
2838832 |
ggctgcgtacaatacacca--aatggtgggatcccttctcggaccctgcgtatgcgggagc |
2838890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 115 - 221
Target Start/End: Original strand, 29334417 - 29334522
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||| ||||||||||| | ||||||||||||| ||||| ||||| || |||| |||| ||||| || |
|
|
| T |
29334417 |
ggaaacagcctcttgtgtaaaaaacaaggtaaggctgcgtacaatacacc-agaatggtgggacccattcccggaccctgcgtatgtgggatctttaatg |
29334515 |
T |
 |
| Q |
215 |
caccggg |
221 |
Q |
| |
|
||||||| |
|
|
| T |
29334516 |
caccggg |
29334522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 77 - 220
Target Start/End: Original strand, 1850624 - 1850764
Alignment:
| Q |
77 |
tgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtggg |
176 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| ||||| |||||||||||| |||||||| ||||| ||| ||||||||| || ||||||||| |
|
|
| T |
1850624 |
tgttgtcatgtgactgaaaggtcacgggttcaagtcccggaaataacctcttgtgt-aaaaacagaataagggtgcgtacaatacatca--aatggtggg |
1850720 |
T |
 |
| Q |
177 |
accccttcccagaccccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
||| ||||| ||||| || |||||| |||||||||||||||| |
|
|
| T |
1850721 |
accacttcctggaccctgcggatgcggaagctttagtgcaccgg |
1850764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 139 - 221
Target Start/End: Complemental strand, 34154903 - 34154823
Alignment:
| Q |
139 |
cagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||| ||||| |||||||||| |||| |||||||||||| |
|
|
| T |
34154903 |
cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcggtagctctagtgcaccggg |
34154823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 117 - 218
Target Start/End: Complemental strand, 7097870 - 7097772
Alignment:
| Q |
117 |
aaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
216 |
Q |
| |
|
||||| ||||||||||||||| |||||||||| ||| ||||||||||||| |||||| ||||||||||| |||| || |||||||||||||||||||| |
|
|
| T |
7097870 |
aaacagcctcttgtgtaaaaa-cagggtaaggttgcgtacaatacaccaa--atggtgagaccccttcccgaaccctgcgtatgcgggagctttagtgca |
7097774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 159 - 220
Target Start/End: Original strand, 25622524 - 25622585
Alignment:
| Q |
159 |
tacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||| |
|
|
| T |
25622524 |
tacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgg |
25622585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 65 - 221
Target Start/End: Original strand, 30006297 - 30006451
Alignment:
| Q |
65 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
164 |
Q |
| |
|
||||| |||| |||||||||||| |||| ||||||| | ||||||| || |||||||||||| | |||| ||||||||||||||| |||| ||||| |
|
|
| T |
30006297 |
aactgataaatttgttgtcatgtgactgaaaggtcatagattcaagtccggaaaacaacctcttatataaacaacagggtaaggctgtgtacattacact |
30006396 |
T |
 |
| Q |
165 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
| ||||||||||||||||||| | || ||||||||||||||||||||||||| |
|
|
| T |
30006397 |
a--aatggtgggaccccttcccggggcctatgtatgcgggagctttagtgcaccggg |
30006451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 115 - 210
Target Start/End: Complemental strand, 24323818 - 24323725
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttt |
210 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||| || ||||| |||| || ||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
24323818 |
ggaaacaacctcttgtgtaaaagacagggtaagcttgcgtataatactccaa--atagtgggaccccttcccagaccctgtatatgcgggagcttt |
24323725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 115 - 210
Target Start/End: Complemental strand, 24360442 - 24360349
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttt |
210 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||| || ||||| |||| || ||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
24360442 |
ggaaacaacctcttgtgtaaaagacagggtaagcttgcgtataatactccaa--atagtgggaccccttcccagaccctgtatatgcgggagcttt |
24360349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 135 - 220
Target Start/End: Complemental strand, 9794471 - 9794388
Alignment:
| Q |
135 |
aaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
||||||||||||| |||||||||||||||||| || |||||| |||||| ||||||| |||||||| | |||||||||||||||| |
|
|
| T |
9794471 |
aaaacagggtaagactgcatacaatacaccaa--atagtgggatcccttcacagacccagcatatgcagaagctttagtgcaccgg |
9794388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 221
Target Start/End: Original strand, 16957375 - 16957440
Alignment:
| Q |
154 |
tacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
16957375 |
tacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggg |
16957440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 50 - 219
Target Start/End: Complemental strand, 22861844 - 22861680
Alignment:
| Q |
50 |
gggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggc |
149 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||| |||| |||||||||| ||||||| ||| || ||||||||||||| | ||||| | |
|
|
| T |
22861844 |
gggtaaccttggcacaactgataaagttgttgtcatgtgactgaaaggtcacggattcaagtcctagaagcagtctcttgtgtaaaaca---agtaagac |
22861748 |
T |
 |
| Q |
150 |
tgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
219 |
Q |
| |
|
||| |||||||| || ||||||||||||||||| | |||| ||||||||||||||| |||||||||| |
|
|
| T |
22861747 |
tgctcacaatacatca--aatggtgggaccccttctcgaaccctgcatatgcgggagctctagtgcaccg |
22861680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 97 - 221
Target Start/End: Complemental strand, 11657835 - 11657708
Alignment:
| Q |
97 |
gtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagg----gtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccc |
192 |
Q |
| |
|
||||||||||||||| | ||||||||||| || ||||||| | | |||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
11657835 |
gtcacgggttcaagttatggaaacaacctattatgtaaaatagtgtaactgtaaggctgcatacaatacaccaa-aatggtgggaccccttcccgaaccc |
11657737 |
T |
 |
| Q |
193 |
cgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||| | |||||| ||||||| ||||||| |
|
|
| T |
11657736 |
tgcacacgcgggaactttagttcaccggg |
11657708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 115 - 221
Target Start/End: Complemental strand, 12575775 - 12575669
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaa-aaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagt |
213 |
Q |
| |
|
||||||| ||||||| ||||| ||||||| ||| | ||| ||||||||||||| |||||||||||||||||| ||||| || ||||| |||||||| || |
|
|
| T |
12575775 |
ggaaacagcctcttgcgtaaataaacaggctaaagttgcgtacaatacaccaa-aatggtgggaccccttcctggaccctgcgtatgcaggagctttggt |
12575677 |
T |
 |
| Q |
214 |
gcaccggg |
221 |
Q |
| |
|
|||||||| |
|
|
| T |
12575676 |
gcaccggg |
12575669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 78 - 190
Target Start/End: Complemental strand, 22908014 - 22907904
Alignment:
| Q |
78 |
gttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtggga |
177 |
Q |
| |
|
||||| |||| |||| ||||||| |||||||||| |||||| ||||||||||||||| ||| |||||| |||||||||||||||| |||||||||| |
|
|
| T |
22908014 |
gttgttatgtgactgaaaggtcaagggttcaagtccaagaaacagcctcttgtgtaaaaa-cagagtaaggttgcatacaatacacca--aatggtggga |
22907918 |
T |
 |
| Q |
178 |
cccct-tcccagac |
190 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
22907917 |
cccctctcccagac |
22907904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 133 - 221
Target Start/End: Original strand, 3771379 - 3771465
Alignment:
| Q |
133 |
aaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||||||||||| ||| | | |||| |||||||||||||||||||| |
|
|
| T |
3771379 |
aaaaaacagggtaaggctgtgaacaatacaccaat--tggtgggaccccttcccggactctgtgtatgtgggagctttagtgcaccggg |
3771465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 170 - 221
Target Start/End: Original strand, 39801591 - 39801642
Alignment:
| Q |
170 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
39801591 |
tggtgggaccccttcccagaccctacgtatgcgggagctttagtgcaccggg |
39801642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 171 - 221
Target Start/End: Complemental strand, 16028683 - 16028633
Alignment:
| Q |
171 |
ggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||| |||||||||||| |
|
|
| T |
16028683 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
16028633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 89 - 151
Target Start/End: Original strand, 22025539 - 22025601
Alignment:
| Q |
89 |
actggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctg |
151 |
Q |
| |
|
|||| ||||||| |||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
22025539 |
actgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctg |
22025601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 129 - 218
Target Start/End: Complemental strand, 31694207 - 31694120
Alignment:
| Q |
129 |
gtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
|||||||||| ||| ||| ||||||||||||||||| || || |||||| |||||||||||| || |||||||||| ||||||||||| |
|
|
| T |
31694207 |
gtgtaaaaaataggctaaagctgcatacaatacacctat--tgatgggactccttcccagaccttgcgtatgcgggagatttagtgcacc |
31694120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 155 - 211
Target Start/End: Complemental strand, 10306548 - 10306493
Alignment:
| Q |
155 |
acaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttta |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||| || ||||||||||||||| |
|
|
| T |
10306548 |
acaatacaccaa-aatggtgggaccccttcccggaccctgcgtatgcgggagcttta |
10306493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 115 - 221
Target Start/End: Complemental strand, 5873434 - 5873331
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||| |||| ||||||||| ||||||||| ||| ||| ||| | || |||||||||||||||||| |
|
|
| T |
5873434 |
ggaaacagcctcttgtgtaaaaat-agggtaaggctaagtacactacaccaat--tggtgggactcctccccggacactgcgtatgcgggagctttagtg |
5873338 |
T |
 |
| Q |
215 |
caccggg |
221 |
Q |
| |
|
|| |||| |
|
|
| T |
5873337 |
catcggg |
5873331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 221
Target Start/End: Complemental strand, 30877628 - 30877573
Alignment:
| Q |
166 |
ataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||| |||||||||||||||| ||||| ||||||| ||||||| |||||||||||| |
|
|
| T |
30877628 |
ataaaggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccggg |
30877573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 144 - 218
Target Start/End: Complemental strand, 12477205 - 12477132
Alignment:
| Q |
144 |
taaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||| || | || ||||| ||||||||||||||| |
|
|
| T |
12477205 |
taaggctgcgtacaatacaccaa-aatggtgggaccccttcccggattctgcgtatgcaagagctttagtgcacc |
12477132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 73 - 221
Target Start/End: Complemental strand, 34074717 - 34074573
Alignment:
| Q |
73 |
aagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatgg |
172 |
Q |
| |
|
|||||||||||| | |||| |||||||| |||||||| |||||| |||||||||||||||||| |||||| ||| | |||||||||| ||||| |
|
|
| T |
34074717 |
aagttgttgtcacatgactgaaaggtcacaagttcaagtcctagaaacagcctcttgtgtaaaaaacacagtaaggttgcgttcaatacacca--aatgg |
34074620 |
T |
 |
| Q |
173 |
tgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|| |||||||||| |||| || |||| |||||| |||||||||||| |
|
|
| T |
34074619 |
cagggccccttcccaaaccctgcgtatgggggagc--tagtgcaccggg |
34074573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 73 - 150
Target Start/End: Complemental strand, 10634301 - 10634224
Alignment:
| Q |
73 |
aagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggct |
150 |
Q |
| |
|
|||||||||||| || |||| ||||||| |||||||||| ||||||||||| |||| ||||| |||||||||||| |
|
|
| T |
10634301 |
aagttgttgtcaagtgactgaaaggtcatgggttcaagtcctagaaacaacctcgtgtgcaaaaatcagggtaaggct |
10634224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 117 - 221
Target Start/End: Complemental strand, 24903807 - 24903705
Alignment:
| Q |
117 |
aaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
216 |
Q |
| |
|
||||| ||| |||||||||||| |||||||| || |||||| ||||||| ||||| ||||||||||| ||| | ||||| |||||| |||| ||||| |
|
|
| T |
24903807 |
aaacagccttttgtgtaaaaaatagggtaagattgtgtacaatccaccaat--tggtgagaccccttcccggacactgcatacgcgggaactttggtgca |
24903710 |
T |
 |
| Q |
217 |
ccggg |
221 |
Q |
| |
|
||||| |
|
|
| T |
24903709 |
ccggg |
24903705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 68 - 109
Target Start/End: Complemental strand, 31362495 - 31362454
Alignment:
| Q |
68 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaa |
109 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
31362495 |
tggtaaagttgttgtcatgtgattggaaggtcacgggttcaa |
31362454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 186
Target Start/End: Complemental strand, 24313732 - 24313617
Alignment:
| Q |
71 |
taaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctc-ttgtgtaaaaaacagggtaaggctgcatacaatacaccaataa |
169 |
Q |
| |
|
|||||||||||||| | |||| ||||||| | |||||||| |||||||||| | || |||| |||||| | ||||| ||| | ||||||||||| || |
|
|
| T |
24313732 |
taaagttgttgtcacatgactgaaaggtcatgtgttcaagtcttggaaacaacccccttctgtagaaaacaagataaggttgcgttcaatacaccaa-aa |
24313634 |
T |
 |
| Q |
170 |
tggtgggaccccttccc |
186 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
24313633 |
tggtgggaccccttccc |
24313617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 186
Target Start/End: Complemental strand, 24356069 - 24355954
Alignment:
| Q |
71 |
taaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctc-ttgtgtaaaaaacagggtaaggctgcatacaatacaccaataa |
169 |
Q |
| |
|
|||||||||||||| | |||| ||||||| | |||||||| |||||||||| | || |||| |||||| | ||||| ||| | ||||||||||| || |
|
|
| T |
24356069 |
taaagttgttgtcacatgactgaaaggtcatgtgttcaagtcttggaaacaacccccttctgtagaaaacaagataaggttgcgttcaatacaccaa-aa |
24355971 |
T |
 |
| Q |
170 |
tggtgggaccccttccc |
186 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
24355970 |
tggtgggaccccttccc |
24355954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 166 - 218
Target Start/End: Original strand, 29297862 - 29297914
Alignment:
| Q |
166 |
ataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| || |||| ||||||||||||| |
|
|
| T |
29297862 |
ataatggtgggatcccttcccggaccccgcaaatacgggtgctttagtgcacc |
29297914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 174 - 221
Target Start/End: Complemental strand, 10943900 - 10943854
Alignment:
| Q |
174 |
gggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||||| ||||| ||| |||||||||||||||||||||||| |
|
|
| T |
10943900 |
gggaccccttcccggaccctgca-atgcgggagctttagtgcaccggg |
10943854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 168 - 219
Target Start/End: Complemental strand, 21784394 - 21784343
Alignment:
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
219 |
Q |
| |
|
|||||||||||||||| || ||||| || |||||||||| |||||||||||| |
|
|
| T |
21784394 |
aatggtgggacccctttccggaccctgcgtatgcgggaggtttagtgcaccg |
21784343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 52 - 87
Target Start/End: Original strand, 31299591 - 31299626
Alignment:
| Q |
52 |
gtaaccttggtgtaactggtaaagttgttgtcatgt |
87 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31299591 |
gtaaccttggtgcaactggtaaagttgttgtcatgt |
31299626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 218
Target Start/End: Complemental strand, 4654477 - 4654427
Alignment:
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
|||||||||| |||||| | |||| ||||||||||||||||||||||||| |
|
|
| T |
4654477 |
aatggtgggatcccttctcgaaccctgcatatgcgggagctttagtgcacc |
4654427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 85
Target Start/End: Original strand, 19438703 - 19438741
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcat |
85 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
19438703 |
gaggggtaaccttggcgcaactggtaaagttgttgtcat |
19438741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 69 - 111
Target Start/End: Complemental strand, 39079925 - 39079883
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagt |
111 |
Q |
| |
|
||||||||||||||||||| || | |||||||||||||||||| |
|
|
| T |
39079925 |
ggtaaagttgttgtcatgtgacagaaaggtcacgggttcaagt |
39079883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 130 - 183
Target Start/End: Complemental strand, 2432395 - 2432342
Alignment:
| Q |
130 |
tgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggacccctt |
183 |
Q |
| |
|
||||||||||| || |||| |||||| |||||||||| |||||||| ||||||| |
|
|
| T |
2432395 |
tgtaaaaaacaaggcaagggtgcatataatacaccaaaaatggtggaacccctt |
2432342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 45 - 85
Target Start/End: Original strand, 41956884 - 41956924
Alignment:
| Q |
45 |
atgaggggtaaccttggtgtaactggtaaagttgttgtcat |
85 |
Q |
| |
|
|||||||||||| |||| | ||||||||||||||||||||| |
|
|
| T |
41956884 |
atgaggggtaacattggcgcaactggtaaagttgttgtcat |
41956924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 94)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 47 - 221
Target Start/End: Original strand, 21646918 - 21647092
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||| ||||||||| | ||||||||||||||||||||||| ||||||||||||| ||||||||| ||||||| |||||||||||||||| ||||||| |
|
|
| T |
21646918 |
gagggataaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaaatagggtaa |
21647017 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21647018 |
ggctgcgtacaatataccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
21647092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 54 - 221
Target Start/End: Complemental strand, 16408777 - 16408610
Alignment:
| Q |
54 |
aaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgca |
153 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
16408777 |
aaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaagactgcg |
16408678 |
T |
 |
| Q |
154 |
tacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
16408677 |
tacaatacaccaataatggtggaaccccttcccggaccccgcatatgcgggagctttagtgcaccggg |
16408610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 47 - 221
Target Start/End: Original strand, 23501747 - 23501915
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||| |||| |||||||||||||||||| | || |||||||||||||||||||||||| |
|
|
| T |
23501747 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtca------cagcctcttgtgtaaaaaacagggtaa |
23501840 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|| ||| ||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
23501841 |
ggttgcgtacaatacaccaataatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggg |
23501915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 47 - 221
Target Start/End: Complemental strand, 13256578 - 13256408
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |||||||||||| ||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
13256578 |
gaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcataggttcaagtcctggag----cctcttgtgtaaaaaacagggtaa |
13256483 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
13256482 |
ggctgcgtacaatacaccaataatagtgggaccccttcccgaaccccgcatctgcgggagctttagtgcaccggg |
13256408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 46 - 221
Target Start/End: Original strand, 20224937 - 20225108
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||| |||| ||||||| |||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
20224937 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacaacctcttgtgt--aaaacagggta |
20225034 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||| ||||| ||||||||||||||| |||||||||||| |
|
|
| T |
20225035 |
aggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
20225108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 46 - 221
Target Start/End: Complemental strand, 6430807 - 6430635
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||| |||| |||||||||||||||||| | ||||||| ||||||||||| ||||||||||| |
|
|
| T |
6430807 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcatggaaacagcctcttgtgta-aaaacagggta |
6430709 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||| |||||||||||| |||||||||||| |||||| ||||| || |||||||||||||||| |||||||| |
|
|
| T |
6430708 |
aggctgcgtacaatacacca--aatggtgggaccacttcccggaccctgcgtatgcgggagctttagcgcaccggg |
6430635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 46 - 217
Target Start/End: Original strand, 5648212 - 5648380
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||||| |||||||||||| |
|
|
| T |
5648212 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcctggaaacagcctcttgtgt-aaaaacagggta |
5648310 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||| ||||| || ||||||||||||| ||||||| |
|
|
| T |
5648311 |
aggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcac |
5648380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 45 - 221
Target Start/End: Complemental strand, 48599006 - 48598834
Alignment:
| Q |
45 |
atgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggt |
144 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
48599006 |
atgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaacagggt |
48598909 |
T |
 |
| Q |
145 |
aaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||| |||| |||||||| |||||| |||||||||||| |
|
|
| T |
48598908 |
aaggctgcgtacaatacacca--aatggtgggaccccttcccggaccatgcatatgccggagctctagtgcaccggg |
48598834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 47 - 221
Target Start/End: Complemental strand, 47528709 - 47528539
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |||| |||||||| ||||||||| ||||||| |||||||||| |||||||||||| |
|
|
| T |
47528709 |
gaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgt--aaaacagggtaa |
47528612 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||| ||||| | ||||| ||||||| |||||||||||| |
|
|
| T |
47528611 |
ggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgaatatgtgggagctctagtgcaccggg |
47528539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 50 - 213
Target Start/End: Original strand, 16911519 - 16911682
Alignment:
| Q |
50 |
gggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggc |
149 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||| ||| |||||||||||||||||| |||||| ||||||||||| ||| ||||||||||| |
|
|
| T |
16911519 |
gggtaaccttggcgcaactggtaaagttgttgtcatgtgacttaaaggtcacgggttcaagtcctagaaacagcctcttgtgtacaaatcagggtaaggc |
16911618 |
T |
 |
| Q |
150 |
tgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagt |
213 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||| ||||| || || |||||||||||||| |
|
|
| T |
16911619 |
tgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtacgcgggagctttagt |
16911682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 46 - 217
Target Start/End: Original strand, 30639333 - 30639501
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||| ||| |||| |||||||| ||||||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
30639333 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcttgtgactgaaaggtcactggttcaagtcctggaaacagactcttgtgt-aaaaacagggta |
30639431 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
||||||| |||||||||||| ||||||| ||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
30639432 |
aggctgcgtacaatacacca--aatggtgagaccccttcccggaccctgcatatgcgggagctttagtgcac |
30639501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 47 - 216
Target Start/End: Original strand, 37494805 - 37494972
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||| |||| |||||||| ||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37494805 |
gaggggtaaccttggtgcaactggtaaagttgttgccatgcgactgaaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaa |
37494904 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
216 |
Q |
| |
|
|| ||||||||||| |||| |||||||||||||||| | ||||| || ||||| |||||||||||||| |
|
|
| T |
37494905 |
ggttgcatacaatatacca--aatggtgggacccctttcgggaccctgcgtatgcaggagctttagtgca |
37494972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 47 - 211
Target Start/End: Original strand, 10660358 - 10660521
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||| |||| ||||| || |||||||| |||||||||||||| ||||||||| |||||| |
|
|
| T |
10660358 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggttacatgttcaagtcctggaaacaacctcttatgtaaaaaatagggtat |
10660457 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| ||| || || ||||||||||||||| |
|
|
| T |
10660458 |
ggctgcatacaatacaccaataatggtgagaccccttccaaga-cctgcgtatgcgggagcttta |
10660521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 47 - 211
Target Start/End: Original strand, 10874503 - 10874666
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||| |||| ||||| || |||||||| |||||||||||||| ||||||||| |||||| |
|
|
| T |
10874503 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggttacatgttcaagtcctggaaacaacctcttatgtaaaaaatagggtat |
10874602 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| ||| || || ||||||||||||||| |
|
|
| T |
10874603 |
ggctgcatacaatacaccaataatggtgagaccccttccaaga-cctgcgtatgcgggagcttta |
10874666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 66 - 221
Target Start/End: Complemental strand, 44363294 - 44363139
Alignment:
| Q |
66 |
actggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacca |
165 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||| |||||||| | ||||| |||| |||||||||||||||||| |||||| ||||| ||||| |
|
|
| T |
44363294 |
actggtaaagttgttgtcatgtgactgaaaggtcacgagttcaagtcctgaaaacagcctcgtgtgtaaaaaacagggtagggctgcgtacaacgcacca |
44363195 |
T |
 |
| Q |
166 |
ataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
| ||||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
44363194 |
aaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggg |
44363139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 68 - 220
Target Start/End: Original strand, 19027823 - 19027973
Alignment:
| Q |
68 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaat |
167 |
Q |
| |
|
||||| ||||||||||| || |||| |||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19027823 |
tggtagagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacaacatcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaat |
19027922 |
T |
 |
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
|||||||||||||| |||||| | || |||| ||||||||||||||||||| |
|
|
| T |
19027923 |
--tggtgggacccctttccagactctgcgtatgtgggagctttagtgcaccgg |
19027973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 47 - 216
Target Start/End: Original strand, 20405047 - 20405210
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaa-aacagggta |
145 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| |||||||||||||||| | |||||| |||||||||||||| ||||||||| |
|
|
| T |
20405047 |
gaggggtaaccttgacgcaactggtaaagttgttgtcatgtgactggaaggtcacgggccta-------gaaacagcctcttgtgtaaaaaaacagggta |
20405139 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
216 |
Q |
| |
|
|| ||| |||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
20405140 |
agattgcgtacaatacactaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgca |
20405210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 43 - 221
Target Start/End: Complemental strand, 5306848 - 5306669
Alignment:
| Q |
43 |
aaatgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagg |
142 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||| |||||||| |||| |||||||||||||||||| ||||||| |||||||||| |||| |||| |
|
|
| T |
5306848 |
aaatgaggggtaaccttggcgcaactggtaaagttgatgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt-aaaatcagg |
5306750 |
T |
 |
| Q |
143 |
gtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatg----cgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||| ||| |||||||||||| ||||||||||||||||||| ||||| || |||| ||||||||||| ||||||||| |
|
|
| T |
5306749 |
gtaaggttgcgtacaatacacca--aatggtgggaccccttcccggaccctgcgtatgtggacgggagctttaatgcaccggg |
5306669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 69 - 221
Target Start/End: Original strand, 35567146 - 35567296
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||| ||||||| || |||||||||||||||||||||||||| ||||| |||||| | |
|
|
| T |
35567146 |
ggtaaagttgttgtcatgtaactgaaaggtcatgggttcaagtcttggaaacagccacttgtgtaaaaaacagggtaaggctgtgtacaacacacca--a |
35567243 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||||| |||| || | ||||||||||||||||||||||| |
|
|
| T |
35567244 |
atggtgggaccccttcccgaaccctgcgtctgcgggagctttagtgcaccggg |
35567296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 47 - 221
Target Start/End: Complemental strand, 11054327 - 11054157
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
|||||||||| |||| | ||||||||||||||||||||||| |||| |||||||||||||||||| | ||||| ||||||||| |||||||||||| |
|
|
| T |
11054327 |
gaggggtaactttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctgaaaacagtctcttgtgt--aaaacagggtaa |
11054230 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
| |||| |||||||||||| ||||| || |||||||||| ||||| ||||||||||||||| |||||||||||| |
|
|
| T |
11054229 |
gactgcgtacaatacacca--aatggcggaaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
11054157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 73 - 211
Target Start/End: Complemental strand, 17043549 - 17043413
Alignment:
| Q |
73 |
aagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatgg |
172 |
Q |
| |
|
|||||||||||| || |||| |||||||| ||||||||| ||||||| |||||||||||||| ||||||||||||||| |||||||||||| ||||| |
|
|
| T |
17043549 |
aagttgttgtcaagtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaatacagggtaaggctgcgtacaatacacca--aatgg |
17043452 |
T |
 |
| Q |
173 |
tgggaccccttcccagaccccgcatatgcgggagcttta |
211 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
17043451 |
tgggaccccttcccagaccctgcatatgctggagcttta |
17043413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 66 - 220
Target Start/End: Original strand, 40915802 - 40915953
Alignment:
| Q |
66 |
actggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacca |
165 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||||||| ||||||| |||||||||| ||||||| ||||||||||| |||||||||||| |
|
|
| T |
40915802 |
actggtaaagttgttgtcatgtgactataaggtcacgggttcaagtcctggaaacagcctcttgtgt-aaaaacaaggtaaggctgcgtacaatacacca |
40915900 |
T |
 |
| Q |
166 |
ataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
|||||||||| |||||||| ||||| || ||||||||||||| |||||||||| |
|
|
| T |
40915901 |
--aatggtgggagcccttcccggaccctgcgtatgcgggagcttcagtgcaccgg |
40915953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 115 - 221
Target Start/End: Complemental strand, 20639772 - 20639667
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| ||||| || |||||||||||||||||| |
|
|
| T |
20639772 |
ggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaa-aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtg |
20639674 |
T |
 |
| Q |
215 |
caccggg |
221 |
Q |
| |
|
||||||| |
|
|
| T |
20639673 |
caccggg |
20639667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 50 - 214
Target Start/End: Original strand, 14983791 - 14983953
Alignment:
| Q |
50 |
gggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggc |
149 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| | | ||||||||||||| ||||||| |||||| |||||||||||||||| ||||||||| |
|
|
| T |
14983791 |
gggtaaccttggcagaactggtaaagttgttgtcatatgattggaaggtcacggattcaagtctttgaaacagcctcttgtgtaaaaaatagggtaaggt |
14983890 |
T |
 |
| Q |
150 |
tgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
||| |||||||||| || |||||||||||||||||| ||||| || |||||||||||||||||| |
|
|
| T |
14983891 |
tgcctacaatacactaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtg |
14983953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 138 - 221
Target Start/End: Original strand, 20225119 - 20225202
Alignment:
| Q |
138 |
acagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
20225119 |
acagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccggg |
20225202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 73 - 221
Target Start/End: Original strand, 54175043 - 54175191
Alignment:
| Q |
73 |
aagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaa-caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatg |
171 |
Q |
| |
|
||||||||||||||| |||| || ||||||| ||||||| ||||| || ||||||||||||||| |||||||||||||| ||||||||||||| |||| |
|
|
| T |
54175043 |
aagttgttgtcatgtgactgaaatgtcacggattcaagtcctggaaaacagcctcttgtgtaaaaa-cagggtaaggctgcgtacaatacaccaa-aatg |
54175140 |
T |
 |
| Q |
172 |
gtgggaccccttcccag-accccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||||||| | |||| |||||||||||||||||||||||||||| |
|
|
| T |
54175141 |
gtgggaccccttccccggaccctgcatatgcgggagctttagtgcaccggg |
54175191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 65 - 221
Target Start/End: Complemental strand, 8473783 - 8473629
Alignment:
| Q |
65 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
164 |
Q |
| |
|
||||||||||||||||||||| | || ||||||| ||||||||||| ||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8473783 |
aactggtaaagttgttgtcatatgaccggaaggttgcgggttcaagtcctggaaacagcctcttgtgt--ttaacagggtaaggctgcatacaatacacc |
8473686 |
T |
 |
| Q |
165 |
aataatggtgggacccctt-cccagacccc-gcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
| |||||||||||||||| ||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
8473685 |
a--aatggtgggaccccttccccggacccctgcatatgcgggagctttagtgcaccggg |
8473629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 79 - 210
Target Start/End: Original strand, 25463108 - 25463237
Alignment:
| Q |
79 |
ttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggac |
178 |
Q |
| |
|
||||||||| |||| |||||||||||||||||| ||||||||||||||||||||||||| ||| |||| ||| ||||| |||||| ||||||||||| |
|
|
| T |
25463108 |
ttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaactgggaaaggttgcgtacaacacacca--aatggtgggac |
25463205 |
T |
 |
| Q |
179 |
cccttcccagaccccgcatatgcgggagcttt |
210 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||| |
|
|
| T |
25463206 |
cccttcccggaccctgcatatgcgggagcttt |
25463237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 94 - 217
Target Start/End: Original strand, 47443958 - 47444079
Alignment:
| Q |
94 |
aaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagacccc |
193 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
47443958 |
aaggtcacgggttcaagtcctggaaacagcctcttgcgtaaaaaacagggtaaggctgcgtacaatacacca--aatggtgggaccccttcccggaccct |
47444055 |
T |
 |
| Q |
194 |
gcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
|||||||| ||||||| ||||||| |
|
|
| T |
47444056 |
gcatatgcaggagcttcagtgcac |
47444079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 69 - 219
Target Start/End: Original strand, 54730225 - 54730376
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaac-agggtaaggctgcatacaatacaccaat |
167 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||| |||||| |||||||||||||||| ||| ||||||||| || ||||||||||| |
|
|
| T |
54730225 |
ggtaaagttgttgtcatgtgaccaaaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaaaataggataaggctgcgtataatacaccaat |
54730324 |
T |
 |
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
219 |
Q |
| |
|
|||| ||| |||||||||| ||||| || ||||||||||||||||||||||| |
|
|
| T |
54730325 |
aatgatggaaccccttcccggaccctgcgtatgcgggagctttagtgcaccg |
54730376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 48 - 221
Target Start/End: Original strand, 54966977 - 54967145
Alignment:
| Q |
48 |
aggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaag |
147 |
Q |
| |
|
||||| |||||||| | ||| ||||||||||||||||||| |||| |||||||| |||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
54966977 |
agggggaaccttggcgcaac-ggtaaagttgttgtcatgtgactgaaaggtcacatgttcaagttctggaaagaacctcttgtgtaaaaaacagggtaag |
54967075 |
T |
 |
| Q |
148 |
gctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
| ||| ||||||| |||| ||||||||||||||||||| |||| |||||||||||||||| |||||||||| |
|
|
| T |
54967076 |
gttgc-tacaatatacca--aatggtgggaccccttcccgtaccctacatatgcgggagcttt-gtgcaccggg |
54967145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 71 - 218
Target Start/End: Complemental strand, 30690340 - 30690188
Alignment:
| Q |
71 |
taaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaa-------cagggtaaggctgcatacaatacac |
163 |
Q |
| |
|
|||||| ||||||| || |||| |||||||||||||||||| ||||| | |||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30690340 |
taaagtggttgtcaagtgactgaaaggtcacgggttcaagtcctggaaaaagcctcttgtgtaaaaaataaaaaacagggtaaggctgcatacaatacac |
30690241 |
T |
 |
| Q |
164 |
caataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
|||| ||||||||||||||||| ||||| || |||||||||||||||||||||| |
|
|
| T |
30690240 |
caat--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcacc |
30690188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 124 - 221
Target Start/End: Complemental strand, 48327869 - 48327772
Alignment:
| Q |
124 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| ||||| ||||||||| || |||||||||||||| |
|
|
| T |
48327869 |
ctcttgtgtaaaaaacagggtaagactgcatacaatacaccaataatggtgggacctcttcccgaaccccacatatgcggaagttttagtgcaccggg |
48327772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 115 - 221
Target Start/End: Complemental strand, 9987947 - 9987843
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||||| |||||||||||||||||| |||| |||||||||||||||||| || |
|
|
| T |
9987947 |
ggaaacaacctcttgtgtaaacaatagggtaaggctgcatacaatacacca--aatggtgggaccccttccttgaccttgcatatgcgggagctttaatg |
9987850 |
T |
 |
| Q |
215 |
caccggg |
221 |
Q |
| |
|
||||||| |
|
|
| T |
9987849 |
caccggg |
9987843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 52 - 219
Target Start/End: Complemental strand, 30352767 - 30352591
Alignment:
| Q |
52 |
gtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaa-----cagggtaa |
146 |
Q |
| |
|
|||||||||| | |||||||||||||||||||| || || | ||||||||||||| ||| ||||||| |||||||||||||||| |||||||| |
|
|
| T |
30352767 |
gtaaccttggcgcaactggtaaagttgttgtcaagtgaccgaaaggtcacgggttagagtcctggaaacagcctcttgtgtaaaaaaaaaaacagggtaa |
30352668 |
T |
 |
| Q |
147 |
g----gctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
219 |
Q |
| |
|
| ||||| ||||||||||||| ||||||||||||||||| | ||||| || ||||||||||||||||||||||| |
|
|
| T |
30352667 |
gtaaagctgcgtacaatacaccaaaaatggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccg |
30352591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 89 - 221
Target Start/End: Complemental strand, 29208035 - 29207907
Alignment:
| Q |
89 |
actggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccag |
188 |
Q |
| |
|
|||| |||||||||||||||||| ||||| |||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||| | |
|
|
| T |
29208035 |
actgaaaggtcacgggttcaagtcctggaaattgcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccgg |
29207940 |
T |
 |
| Q |
189 |
accccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||| |
|
|
| T |
29207939 |
accctgcatatgcgggagctctagtgcaccggg |
29207907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 71 - 221
Target Start/End: Complemental strand, 9832468 - 9832322
Alignment:
| Q |
71 |
taaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataat |
170 |
Q |
| |
|
|||| ||||||| || | |||| |||||||||||||||||| | ||||| |||||||||||||| |||||||||||||| ||||||||||||| || |
|
|
| T |
9832468 |
taaaattgttgtgatctgactgaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--at |
9832373 |
T |
 |
| Q |
171 |
ggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| ||| || |||||||||||| |
|
|
| T |
9832372 |
ggtgggaccccttcccggaccctgcatatgcaggaactctagtgcaccggg |
9832322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 71 - 214
Target Start/End: Complemental strand, 30581624 - 30581481
Alignment:
| Q |
71 |
taaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaa-aaaacagggtaaggctgcatacaatacaccaataa |
169 |
Q |
| |
|
|||||||||||||| | ||| ||||||| |||||||||| |||||||||||||||||||| |||||||||||||| || ||||||||||||| || |
|
|
| T |
30581624 |
taaagttgttgtcacatcactaaaaggtcaagggttcaagtcgtggaaacaacctcttgtgtaaaaaaacagggtaagggtgtgtacaatacaccaa-aa |
30581526 |
T |
 |
| Q |
170 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
||||||||||||||||| ||||| ||||||| |||||||||||| |
|
|
| T |
30581525 |
tggtgggaccccttcccggaccctgcatatgtaggagctttagtg |
30581481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 46 - 179
Target Start/End: Original strand, 14590790 - 14590922
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgt-aaaaaacagggt |
144 |
Q |
| |
|
|||| ||||||||||| | ||||||||||||||||||||||| |||| |||||||||| ||||||| |||||| |||||||| | |||||||||||| |
|
|
| T |
14590790 |
tgagtggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacggattcaagtcctagaaacagcctcttgtctaaaaaaacagggt |
14590889 |
T |
 |
| Q |
145 |
aaggctgcatacaatacaccaataatggtgggacc |
179 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| |
|
|
| T |
14590890 |
aaggctgcatacaatacatca--aatggtgggacc |
14590922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 115 - 221
Target Start/End: Original strand, 25629071 - 25629175
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||| ||||||||||||| |||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
25629071 |
ggaaacagtctcttgtgtaaaaaatagggtaaggctgtgtacaatacaccaa--atggtgggaccccttcccggaccctacatatgcgggagctttagtg |
25629168 |
T |
 |
| Q |
215 |
caccggg |
221 |
Q |
| |
|
||||||| |
|
|
| T |
25629169 |
caccggg |
25629175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 69 - 212
Target Start/End: Complemental strand, 39029220 - 39029078
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
||||||||||||||| ||| ||| ||||||| |||||||| ||||||| ||||||||||||||||||||||||||||| |||||||||| || | |
|
|
| T |
39029220 |
ggtaaagttgttgtcgtgtgactaaaaggtcataggttcaagccttggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacacgaa-a |
39029122 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagctttag |
212 |
Q |
| |
|
||||||||||| ||| || ||||| ||||||||||||||||||| |
|
|
| T |
39029121 |
atggtgggaccactttccggaccctgcatatgcgggagctttag |
39029078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 56 - 221
Target Start/End: Complemental strand, 487306 - 487135
Alignment:
| Q |
56 |
ccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcata |
155 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||| |||| |||||||||||||||||| ||||||||||||||||||| |||||| ||||| ||||| || |
|
|
| T |
487306 |
ccttggcgtaac-ggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcttggaaacaacctcttgtgtataaaacaaggtaaagctgcgta |
487208 |
T |
 |
| Q |
156 |
caatacaccaata-------atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||| || | |||| ||||||||||||| || | || |||||||||||||||||||||||| |
|
|
| T |
487207 |
caatacactaaaatggtgggatggcgggaccccttcccggattctgcgaatgcgggagctttagtgcaccggg |
487135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 68 - 218
Target Start/End: Original strand, 25343162 - 25343312
Alignment:
| Q |
68 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaat |
167 |
Q |
| |
|
||||||||||||||||| || |||| ||||||| ||||||||| ||||| | ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
25343162 |
tggtaaagttgttgtcacgtgactgataggtcacaggttcaagttctggaaatagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaa |
25343261 |
T |
 |
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
|| ||| ||||||||||| ||| || || |||| | ||||||||| ||||| |
|
|
| T |
25343262 |
aagggttggaccccttcctagatcctgcgtatgtgagagctttagagcacc |
25343312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 72 - 212
Target Start/End: Complemental strand, 49938746 - 49938611
Alignment:
| Q |
72 |
aaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatg |
171 |
Q |
| |
|
||||||||||||| || |||| |||||||| ||||||||| ||||||| ||||||||||||||| | |||||||| || ||||||||||||| |||| |
|
|
| T |
49938746 |
aaagttgttgtcacgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaa-cggggtaagg-tg--tacaatacaccaa-aatg |
49938652 |
T |
 |
| Q |
172 |
gtgggaccccttcccagaccccgcatatgcgggagctttag |
212 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
49938651 |
gtgggaccccttcccataccctgcatatgcgggagctttag |
49938611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 117 - 220
Target Start/End: Complemental strand, 51865149 - 51865048
Alignment:
| Q |
117 |
aaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
216 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||| |||||||||||| ||||||||| ||||||||| ||||| || ||||||||||||||| |||| |
|
|
| T |
51865149 |
aaacagcctcttgtgtaaaaaacatggtaaggctgcgtacaatacacca--aatggtggggccccttcccggaccctgcgtatgcgggagctttattgca |
51865052 |
T |
 |
| Q |
217 |
ccgg |
220 |
Q |
| |
|
|||| |
|
|
| T |
51865051 |
ccgg |
51865048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 69 - 217
Target Start/End: Complemental strand, 20908797 - 20908649
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaag-gtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaat |
167 |
Q |
| |
|
||||||||||||||||||| |||| || || || |||||||| | ||||||| | |||| | ||||||| | ||||||||||| ||||||||||||| |
|
|
| T |
20908797 |
ggtaaagttgttgtcatgtgactgaaaatgttacatgttcaagtcatggaaacatcgtcttttctaaaaaagaaggtaaggctgcgtacaatacaccaa- |
20908699 |
T |
 |
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
||||||||||||||||||| |||| || ||||||||||||||||||||| |
|
|
| T |
20908698 |
aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcac |
20908649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 72 - 219
Target Start/End: Complemental strand, 30496476 - 30496333
Alignment:
| Q |
72 |
aaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatg |
171 |
Q |
| |
|
||||||||||||| || |||| ||||||||| |||||||| | ||||||| ||||||||||||| | ||||||||||||||||||||||||| |||| |
|
|
| T |
30496476 |
aaagttgttgtcacgtgactgaaaggtcacgtgttcaagtcatggaaacagcctcttgtgtaaaca--cgggtaaggctgcatacaatacacca--aatg |
30496381 |
T |
 |
| Q |
172 |
gtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
219 |
Q |
| |
|
| ||||| ||||||| |||| || |||| ||||||||||||||||| |
|
|
| T |
30496380 |
gggggactccttcccggaccgtgcttatgatggagctttagtgcaccg |
30496333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 74 - 221
Target Start/End: Complemental strand, 39077948 - 39077805
Alignment:
| Q |
74 |
agttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggt |
173 |
Q |
| |
|
|||||||||||||| | || |||||||||||||||||| ||||||| |||||||||| |||||||||||||| ||| ||||||| |||| |||||| |
|
|
| T |
39077948 |
agttgttgtcatgtgattgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaacagggtaaggttgcgtacaatatacca--aatggt |
39077853 |
T |
 |
| Q |
174 |
gggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
| ||| ||| || ||||| ||||||||||||||| |||||||||||| |
|
|
| T |
39077852 |
gagacatctttccggaccctgcatatgcgggagctctagtgcaccggg |
39077805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 47 - 221
Target Start/End: Complemental strand, 55766647 - 55766475
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcac-gggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| || |||||||||| |||||||||| ||||||| |||||||| |||||||||| |
|
|
| T |
55766647 |
gaggggtaaccttgacgcaactggtaaagttgttgtcatgtgaccggaaggtcacggggttcaagttttggaaacagtttcttgtgt-gtaaacagggta |
55766549 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||| |||||||||| |||||||| ||||| |||| |||| || |||||| |||||||||||||||||| |
|
|
| T |
55766548 |
aggctgcgtacaatacac--tgaatggtggaaccccatcccggaccttgcgtatgcgagagctttagtgcaccggg |
55766475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 71 - 221
Target Start/End: Complemental strand, 32478942 - 32478801
Alignment:
| Q |
71 |
taaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataat |
170 |
Q |
| |
|
||||||||||||||||| || | ||||||| ||||||||| ||||||||||||| ||||||||| ||||||||||||| |||||||||| || |
|
|
| T |
32478942 |
taaagttgttgtcatgtgaccgagaggtcacaggttcaagtcctggaaacaacctctagtgtaaaaa-cagggtaaggctg-----aatacaccaa--at |
32478851 |
T |
 |
| Q |
171 |
ggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||| ||||| || |||||||||||||| |||||||||| |
|
|
| T |
32478850 |
ggtgggaccccttcccggacccagcgtatgcgggagcttt-gtgcaccggg |
32478801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 135 - 221
Target Start/End: Original strand, 16494259 - 16494345
Alignment:
| Q |
135 |
aaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||||||| ||||||||||| | ||||||| |||||||||| |||||| |
|
|
| T |
16494259 |
aaaacagggtaaagctgcatacaatacaccaaaaatggtgggaccctttcccagaccctgtgtatgcggaagctttagtgtaccggg |
16494345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 76 - 217
Target Start/End: Complemental strand, 41018945 - 41018807
Alignment:
| Q |
76 |
ttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgg |
175 |
Q |
| |
|
||||||||| || |||| |||||||||||||||||| |||||||||||||||||| |||| ||||||||||| | |||||||||||| ||| |||| |
|
|
| T |
41018945 |
ttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgt-aaaattagggtaaggctacgtacaatacacca--aatagtgg |
41018849 |
T |
 |
| Q |
176 |
gaccccttcccagaccccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
|||||||||||||||| || |||| || |||||||||||| |
|
|
| T |
41018848 |
gaccccttcccagaccttgcgtatggaggggctttagtgcac |
41018807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 50 - 155
Target Start/End: Complemental strand, 17315476 - 17315372
Alignment:
| Q |
50 |
gggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggc |
149 |
Q |
| |
|
|||||||||||| | ||| ||||||||||||||||||| |||| |||||||||||||||| | ||||||||||||||||| ||||||| |||||||| |
|
|
| T |
17315476 |
gggtaaccttggcgcaaccggtaaagttgttgtcatgtgactgaaaggtcacgggttcaattcctcgaaacaacctcttgtgt-aaaaacaaggtaaggc |
17315378 |
T |
 |
| Q |
150 |
tgcata |
155 |
Q |
| |
|
|||||| |
|
|
| T |
17315377 |
tgcata |
17315372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 153 - 221
Target Start/End: Complemental strand, 33836564 - 33836496
Alignment:
| Q |
153 |
atacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||| |||| |
|
|
| T |
33836564 |
atacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacggg |
33836496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 69 - 153
Target Start/End: Original strand, 43035224 - 43035308
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgca |
153 |
Q |
| |
|
|||||||||||||||| || |||| |||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
43035224 |
ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtccaggaaacaacctcttgtgtaagaaacacggtaaggctgca |
43035308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 69 - 152
Target Start/End: Complemental strand, 42164307 - 42164225
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgc |
152 |
Q |
| |
|
|||||| |||||||||||| |||| |||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42164307 |
ggtaaaattgttgtcatgtgactgaaaggtcacgggttcaagtcttggaaacaacctcttgtgta-aaaacagggtaaggctgc |
42164225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 115 - 217
Target Start/End: Original strand, 21489109 - 21489210
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
||||||| ||||||| ||||||||||| ||||| |||| |||||| |||||| ||||||||||||||||||| |||| || |||||||||||||| ||| |
|
|
| T |
21489109 |
ggaaacagcctcttgcgtaaaaaacagagtaagactgcgtacaatgcaccaa-aatggtgggaccccttcccgaaccctgcgtatgcgggagctttcgtg |
21489207 |
T |
 |
| Q |
215 |
cac |
217 |
Q |
| |
|
||| |
|
|
| T |
21489208 |
cac |
21489210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 47 - 218
Target Start/End: Complemental strand, 55830902 - 55830733
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgg-gttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| | |||||||||||| |||||||| ||||||| ||||||||| |||||||||| |
|
|
| T |
55830902 |
gaggggtaaccttgacgcaactggtaaagttgttgtcatgtgatcggaaggtcacggagttcaagttttggaaacagtctcttgtgt-gtaaacagggta |
55830804 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
| ||||| |||||||||| |||||||| ||||| |||| |||| || |||||| ||||||||||||||| |
|
|
| T |
55830803 |
atgctgcgtacaatacac--tgaatggtggaaccccatcccggaccttgcgtatgcgagagctttagtgcacc |
55830733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 76 - 207
Target Start/End: Complemental strand, 7385628 - 7385499
Alignment:
| Q |
76 |
ttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgg |
175 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||| ||||||| |||| ||||||||||| ||||||||| || | |||||||||| |||||||| |
|
|
| T |
7385628 |
ttgttgtcatgtgactgaaaggtcacgggttcaagccctggaaacagcctcatgtgtaaaaaatagggtaaggttgtgtgcaatacacca--aatggtgg |
7385531 |
T |
 |
| Q |
176 |
gaccccttcccagaccccgcatatgcgggagc |
207 |
Q |
| |
|
||||| ||||| ||||| | ||||||||||| |
|
|
| T |
7385530 |
gaccctttcccggaccctgtgtatgcgggagc |
7385499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 69 - 192
Target Start/End: Complemental strand, 47441689 - 47441568
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
|||||||||||||||| || |||| |||||||| ||||||||| |||||| ||||| |||||||| ||||||||||||| |||||||||||| | |
|
|
| T |
47441689 |
ggtaaagttgttgtcacgtgactgaaaggtcacaggttcaagtccaagaaacagtctcttttgtaaaaatcagggtaaggctgtgtacaatacacca--a |
47441592 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccc |
192 |
Q |
| |
|
||||| |||||||||||| ||||| |
|
|
| T |
47441591 |
atggttggaccccttcccggaccc |
47441568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 70 - 210
Target Start/End: Complemental strand, 3580994 - 3580860
Alignment:
| Q |
70 |
gtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataa |
169 |
Q |
| |
|
|||||||||||||||||| |||| || |||||| |||||||| || || ||||||||||||||| || |||||||||| | |||||||||| || |
|
|
| T |
3580994 |
gtaaagttgttgtcatgtgactgaaaagtcacgagttcaagtctggaaa----cctcttgtgtaaaaaccatggtaaggctgtgtgcaatacacca--aa |
3580901 |
T |
 |
| Q |
170 |
tggtgggaccccttcccagaccccgcatatgcgggagcttt |
210 |
Q |
| |
|
|| | |||||||||||| ||||| ||||||| ||||||||| |
|
|
| T |
3580900 |
tgctaggaccccttcccggaccctgcatatgtgggagcttt |
3580860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 45 - 109
Target Start/End: Complemental strand, 5313177 - 5313113
Alignment:
| Q |
45 |
atgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaa |
109 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||| | || |||||||||||||||| |
|
|
| T |
5313177 |
atgacgggtaaccttggcgtaactggtaaagttgttgtcatgtgattgaaaggtcacgggttcaa |
5313113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 115 - 221
Target Start/End: Complemental strand, 7909393 - 7909289
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgc-gggagctttagt |
213 |
Q |
| |
|
||||||| |||||||||||||| |||||||||| ||| |||||||||||| ||||||||||||||||||| |||| || ||||| |||||||||||| |
|
|
| T |
7909393 |
ggaaacagtctcttgtgtaaaaa-cagggtaaggttgcgtacaatacacca--aatggtgggaccccttcccgaaccctgcgtatgcggggagctttagt |
7909297 |
T |
 |
| Q |
214 |
gcaccggg |
221 |
Q |
| |
|
||| |||| |
|
|
| T |
7909296 |
gcatcggg |
7909289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 169 - 221
Target Start/End: Original strand, 32484307 - 32484359
Alignment:
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
32484307 |
atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggg |
32484359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 165 - 221
Target Start/End: Complemental strand, 38755973 - 38755917
Alignment:
| Q |
165 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
38755973 |
aataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggg |
38755917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 115 - 209
Target Start/End: Original strand, 49796820 - 49796911
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctt |
209 |
Q |
| |
|
||||||| |||||||||| |||| || ||||||||||| ||||||||||||| |||||||||||||||||| |||| || ||||||||||||| |
|
|
| T |
49796820 |
ggaaacagcctcttgtgttaaaa-catggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccgaaccctgcgtatgcgggagctt |
49796911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 71 - 184
Target Start/End: Complemental strand, 23580365 - 23580253
Alignment:
| Q |
71 |
taaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataat |
170 |
Q |
| |
|
|||||||||||||| || |||| |||||||||||||||||| |||| | ||||||||||||||||||||| ||| |||| || ||||||||| ||| |
|
|
| T |
23580365 |
taaagttgttgtcacgtgactgaaaggtcacgggttcaagttctagaaagagcctcttgtgtaaaaaacaggggaagactgcgtaggatacaccaa-aat |
23580267 |
T |
 |
| Q |
171 |
ggtgggaccccttc |
184 |
Q |
| |
|
|| | ||||||||| |
|
|
| T |
23580266 |
ggcgagaccccttc |
23580253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 168 - 221
Target Start/End: Original strand, 28494224 - 28494277
Alignment:
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||| |||||||||||| |
|
|
| T |
28494224 |
aatggtgggaccccttcccagatcctgcatatgcgggagctctagtgcaccggg |
28494277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 168 - 221
Target Start/End: Original strand, 38786682 - 38786735
Alignment:
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||| |||||||||||| |
|
|
| T |
38786682 |
aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
38786735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 73 - 165
Target Start/End: Original strand, 51420553 - 51420646
Alignment:
| Q |
73 |
aagttgttgtcatgtaactggaaggtcacggg-ttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacca |
165 |
Q |
| |
|
|||||||||||| || |||| ||||||| | ||||||| | ||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
51420553 |
aagttgttgtcacgtgactgaaaggtcagttgattcaagtcatggaaacaacctcttgtgtagaaaacagggtaaggctgggtacaatacacca |
51420646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 68 - 192
Target Start/End: Original strand, 44357195 - 44357318
Alignment:
| Q |
68 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaat |
167 |
Q |
| |
|
|||||||||| |||| ||||||||| ||||||| | |||||||| |||||||||| |||||||| ||| || ||||| | | ||||||||||||| |
|
|
| T |
44357195 |
tggtaaagttattgttatgtaactgaaaggtcatgagttcaagtcctagaaacaaccttttgtgtaataaatagagtaagacgacgtacaatacaccaa- |
44357293 |
T |
 |
| Q |
168 |
aatggtgggaccccttcccagaccc |
192 |
Q |
| |
|
||||| |||||| |||||||||||| |
|
|
| T |
44357294 |
aatggcgggacctcttcccagaccc |
44357318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 130 - 220
Target Start/End: Complemental strand, 10277855 - 10277767
Alignment:
| Q |
130 |
tgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
|||| |||| ||| ||||||||| ||||||||||||| |||||| |||||||||||||||| ||||||||||||| | ||||| ||||| |
|
|
| T |
10277855 |
tgtataaaataggataaggctgcgtacaatacaccaa--atggtgaaaccccttcccagaccctgcatatgcgggagttctagtgaaccgg |
10277767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 117 - 218
Target Start/End: Complemental strand, 12711561 - 12711461
Alignment:
| Q |
117 |
aaacaacctcttgtgtaaaaaac-agggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgc |
215 |
Q |
| |
|
||||||| |||||||||||||| |||||||| |||| ||||||||||||| |||| ||||||||||| |||||| || ||||||| | ||||||||| |
|
|
| T |
12711561 |
aaacaacatcttgtgtaaaaaaatagggtaagactgcgtacaatacaccaa--atggcgggaccccttctcagacctagcgtatgcggaaactttagtgc |
12711464 |
T |
 |
| Q |
216 |
acc |
218 |
Q |
| |
|
||| |
|
|
| T |
12711463 |
acc |
12711461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 115 - 221
Target Start/End: Original strand, 36589765 - 36589870
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
||||||| |||||||||||||||||| ||||| |||| ||| |||||||| |||||||||||||||||| |||| |||||||||||||| ||| |
|
|
| T |
36589765 |
ggaaacagcctcttgtgtaaaaaacatggtaatgctgttgacagtacaccaa-aatggtgggaccccttcctgaaccctatgtatgcgggagctttggtg |
36589863 |
T |
 |
| Q |
215 |
caccggg |
221 |
Q |
| |
|
||||||| |
|
|
| T |
36589864 |
caccggg |
36589870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 168 - 221
Target Start/End: Original strand, 11394925 - 11394978
Alignment:
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||| || ||||| || ||||||||||||||||||||||||| |
|
|
| T |
11394925 |
aatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccggg |
11394978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 168 - 221
Target Start/End: Original strand, 11404652 - 11404705
Alignment:
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||| || ||||| || ||||||||||||||||||||||||| |
|
|
| T |
11404652 |
aatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccggg |
11404705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 44 - 101
Target Start/End: Complemental strand, 29879681 - 29879624
Alignment:
| Q |
44 |
aatgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcac |
101 |
Q |
| |
|
||||||||||||| |||||| ||||| ||||||||||||||||| ||| ||||||||| |
|
|
| T |
29879681 |
aatgaggggtaacattggtgcaactgataaagttgttgtcatgtgactagaaggtcac |
29879624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 137 - 220
Target Start/End: Original strand, 2813169 - 2813253
Alignment:
| Q |
137 |
aacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttt-agtgcaccgg |
220 |
Q |
| |
|
||||||||||| |||| ||||||||| ||||||||||||||||| ||||| || || |||||||||||||| |||||||||| |
|
|
| T |
2813169 |
aacagggtaagactgcgtacaatacatcaataatggtgggaccctttcccgaacgatgcgtatgcgggagctttaagtgcaccgg |
2813253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 81 - 217
Target Start/End: Original strand, 7038041 - 7038174
Alignment:
| Q |
81 |
gtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccc |
180 |
Q |
| |
|
||||||| |||| |||||||| ||||||||| | ||||| | |||||||||||||| |||||||| || | ||||||||||||| ||||||||| | | |
|
|
| T |
7038041 |
gtcatgtgactgaaaggtcacaggttcaagtcctg-aaacagcttcttgtgtaaaaaatagggtaagacttcgtacaatacaccaa-aatggtggggcac |
7038138 |
T |
 |
| Q |
181 |
cttcccagaccccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
|| ||| ||||| || ||| | ||||||||||||||| |
|
|
| T |
7038139 |
ctacccggaccctgcgtatac-ggagctttagtgcac |
7038174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 102 - 185
Target Start/End: Complemental strand, 17079777 - 17079696
Alignment:
| Q |
102 |
gggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcc |
185 |
Q |
| |
|
|||||||||| |||||||| ||||||||| ||||||||||||||||||||||||||| | | ||||||||||||| |||| |
|
|
| T |
17079777 |
gggttcaagtcttggaaacaatatcttgtgtataaaacagggtaaggctgcatacaatacgcta--aatggtgggaccctttcc |
17079696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 78 - 214
Target Start/End: Complemental strand, 32629418 - 32629285
Alignment:
| Q |
78 |
gttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtggga |
177 |
Q |
| |
|
|||||||||| |||| |||||||||||||||| | |||||| |||||||| ||||||||||||||||| || ||| ||||||||| | ||| |||| |
|
|
| T |
32629418 |
gttgtcatgtgactgaaaggtcacgggttcaaatcctcgaaacagcctcttgt-aaaaaaacagggtaaggccgcctac-atacaccaa-attggcggga |
32629322 |
T |
 |
| Q |
178 |
ccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
||||||||| |||| || |||| ||||| ||||||| |
|
|
| T |
32629321 |
ccccttcccggaccttgcgtatgtgggagttttagtg |
32629285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 169 - 221
Target Start/End: Complemental strand, 40553998 - 40553946
Alignment:
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||| ||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
40553998 |
atggtgtgaccccttcccggaccctgcgtatgcgggagctttagtgcaccggg |
40553946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 169 - 221
Target Start/End: Original strand, 44718641 - 44718693
Alignment:
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||| ||||||| |
|
|
| T |
44718641 |
atggtgggaccccttcccagaccctgcgtatgcgggagctttagcacaccggg |
44718693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 165 - 216
Target Start/End: Original strand, 8820578 - 8820629
Alignment:
| Q |
165 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||| ||| ||||||||| |
|
|
| T |
8820578 |
aataatggtgggaccccttcccagaccctgcgtatgcgagagttttagtgca |
8820629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 170 - 221
Target Start/End: Original strand, 19027986 - 19028037
Alignment:
| Q |
170 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||| ||||||| |||||| | ||||||||||||||||||||||||| |
|
|
| T |
19027986 |
tggtgggactccttcccggaccccacttatgcgggagctttagtgcaccggg |
19028037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 127 - 186
Target Start/End: Complemental strand, 35894563 - 35894505
Alignment:
| Q |
127 |
ttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttccc |
186 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
35894563 |
ttgtgtaaaaaacacggtaagtgtgcgtacaatacaccaa-aatggtgggaccccttccc |
35894505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 134 - 221
Target Start/End: Complemental strand, 36816479 - 36816393
Alignment:
| Q |
134 |
aaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||| | |||||| ||||||||||||| || |||||||| |||||| ||||| | |||||||||||||||||| |||||| |
|
|
| T |
36816479 |
aaaaacagggcagggctgcgtacaatacaccaaaaa-ggtgggactccttcctggaccctgtgtatgcgggagctttagtgtaccggg |
36816393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 162 - 216
Target Start/End: Complemental strand, 47482918 - 47482864
Alignment:
| Q |
162 |
accaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
216 |
Q |
| |
|
||||| ||||||||||||||||||| ||||| || |||||||||||||| ||||| |
|
|
| T |
47482918 |
accaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtgca |
47482864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 179 - 221
Target Start/End: Original strand, 56322984 - 56323026
Alignment:
| Q |
179 |
cccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
56322984 |
cccttcccggaccccggatatgcgggagctttagtgcaccggg |
56323026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 168 - 221
Target Start/End: Original strand, 25388249 - 25388302
Alignment:
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||||||||||| ||||| || ||||| |||||||||||||||||| |
|
|
| T |
25388249 |
aatggtgggaccccttcccggaccctgcgtatgcatgagctttagtgcaccggg |
25388302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 69 - 138
Target Start/End: Complemental strand, 54640498 - 54640429
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaa |
138 |
Q |
| |
|
|||||| ||||||||| || ||| |||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
54640498 |
ggtaaaattgttgtcacgtggctgaaaggtcacgggttcaagtcttggaaacagcctcttgtgtaaaaaa |
54640429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 221
Target Start/End: Complemental strand, 50555721 - 50555665
Alignment:
| Q |
165 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||| |||||||||| ||||| || ||||| |||| |||||||||||||| |
|
|
| T |
50555721 |
aataatggtggaaccccttcccggaccctgcgtatgcaggagttttagtgcaccggg |
50555665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 50 - 87
Target Start/End: Original strand, 18969698 - 18969735
Alignment:
| Q |
50 |
gggtaaccttggtgtaactggtaaagttgttgtcatgt |
87 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
18969698 |
gggtaaccttggcgcaactggtaaagttgttgtcatgt |
18969735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 180 - 221
Target Start/End: Original strand, 35532077 - 35532118
Alignment:
| Q |
180 |
ccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
35532077 |
ccttcccggaccctgcgtatgcgggagctttagtgcaccggg |
35532118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 120; Significance: 1e-61; HSPs: 67)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 46 - 221
Target Start/End: Original strand, 14530271 - 14530446
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
14530271 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggta |
14530370 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||| | ||||||||||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
14530371 |
aggctacgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggg |
14530446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 42 - 221
Target Start/End: Original strand, 10543647 - 10543826
Alignment:
| Q |
42 |
aaaatgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacag |
141 |
Q |
| |
|
||||| |||||||||||||| | ||||| ||||||||||||||||| |||| |||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
10543647 |
aaaataaggggtaaccttggcgcaactgataaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacggcctcttgtgtaaaaaacag |
10543746 |
T |
 |
| Q |
142 |
ggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
10543747 |
ggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggg |
10543826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 47 - 219
Target Start/End: Original strand, 5840982 - 5841154
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||||| || || ||||||||||||||||| ||||||||||||||||||||||| |||||| ||| |||||||||||| ||||||| |
|
|
| T |
5840982 |
gaggggtaaccttggtgcaaatgataaagttgttgtcatgtgactggaaggtcacgggttcaagtcctagaaacagccttttgtgtaaaaaatagggtaa |
5841081 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
219 |
Q |
| |
|
|| ||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5841082 |
ggatgcgtacaatacatcaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccg |
5841154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 47 - 221
Target Start/End: Complemental strand, 8455497 - 8455325
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |||||||||||||| ||||||||| |
|
|
| T |
8455497 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacacagggtaa |
8455398 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||| ||||| || ||||| ||||||||||||||||||| |
|
|
| T |
8455397 |
ggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcgtatgccggagctttagtgcaccggg |
8455325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 48 - 221
Target Start/End: Complemental strand, 24200805 - 24200632
Alignment:
| Q |
48 |
aggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaag |
147 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||| |||| || ||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
24200805 |
aggggtaaccttgatgcaactggtaaagttgttgtcatgtgactgaaaagtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaag |
24200706 |
T |
 |
| Q |
148 |
gctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||| ||||||||||||| |||||||||| |||||||| ||||| | |||| | |||||||||||||||||| |
|
|
| T |
24200705 |
gctgcgtacaatacaccaaaaatggtgggaacccttcccggaccctgagtatgtgagagctttagtgcaccggg |
24200632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 49 - 220
Target Start/End: Original strand, 11514392 - 11514560
Alignment:
| Q |
49 |
ggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaagg |
148 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||| ||||||||||||||||||||| | ||||||| |||||||||||||||||| |||||| |
|
|
| T |
11514392 |
ggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaactcctggaaacagcctcttgtgtaaaaaacaaagtaagg |
11514491 |
T |
 |
| Q |
149 |
ctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
|||| |||||||||||| |||||||||| |||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
11514492 |
ctgcgtacaatacacca--aatggtggga-cccttcccagaccctgcgtatgcgggagctttagtgcaccgg |
11514560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 39 - 221
Target Start/End: Complemental strand, 21779448 - 21779270
Alignment:
| Q |
39 |
ataaaaatgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaa |
138 |
Q |
| |
|
|||||| |||||||||||||||| | ||||||| ||||||||||||||| |||| |||||||||||||||||| ||| ||| |||||||||| |||| |
|
|
| T |
21779448 |
ataaaagtgaggggtaaccttggcgcaactggtgaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggagacagcctcttgtgt--aaaa |
21779351 |
T |
 |
| Q |
139 |
cagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||| ||| |||||||||||| ||||||||||||||||||| ||||| ||||||||||||||| |||||||||||| |
|
|
| T |
21779350 |
cagggtaaggttgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
21779270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 46 - 221
Target Start/End: Complemental strand, 25079900 - 25079726
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgt-aaaaaacagggt |
144 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |||||||| ||| |
|
|
| T |
25079900 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcttagaaacaacctcttgtgtaaaaaaacaaggt |
25079801 |
T |
 |
| Q |
145 |
aaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||| ||| ||||||||||| ||||||||||||||||||| ||||| || ||||| |||||||||||||||||| |
|
|
| T |
25079800 |
aaggatgcgtacaatacacc--gaatggtgggaccccttcccggaccctgcgtatgcaagagctttagtgcaccggg |
25079726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 45 - 221
Target Start/End: Original strand, 23397718 - 23397890
Alignment:
| Q |
45 |
atgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggt |
144 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |||| ||||||| |||||||||| ||||||| |||||||||| |||| ||||| |
|
|
| T |
23397718 |
atgaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgt--aaaatagggt |
23397815 |
T |
 |
| Q |
145 |
aaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||| | |||||||||||| ||||||||||||||||| | ||||| |||||||||||||| |||||||||||| |
|
|
| T |
23397816 |
aaggctacgtacaatacacca--aatggtgggaccccttctcggaccctacatatgcgggagctctagtgcaccggg |
23397890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 47 - 221
Target Start/End: Original strand, 9671134 - 9671305
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaag-gtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
||||||||||||||| | ||| ||||||||||||||||||| ||||||| ||||||||||||| | ||||||| |||||||||||||| ||||||| |
|
|
| T |
9671134 |
gaggggtaaccttggcgcaaccggtaaagttgttgtcatgtgactggaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggta |
9671231 |
T |
 |
| Q |
146 |
aggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
9671232 |
aggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggg |
9671305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 47 - 220
Target Start/End: Complemental strand, 12024099 - 12023929
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| ||||||||||| |||||||||||| |
|
|
| T |
12024099 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgta-aaaacagggtaa |
12024001 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||| |||| ||||| || ||| || ||||||| |||||||| |
|
|
| T |
12024000 |
ggctgcgtacaatacacca--aatggtgggaccccctcccggaccctgcgtatttggaagctttaatgcaccgg |
12023929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 65 - 221
Target Start/End: Original strand, 17667974 - 17668128
Alignment:
| Q |
65 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
164 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| ||||| ||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
17667974 |
aactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaagaacctcttgtgtaaaaatcagggtaaggctgcgtacaatacacc |
17668073 |
T |
 |
| Q |
165 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
| |||||||| |||||||| | |||| || ||| |||||||||||||||||||| |
|
|
| T |
17668074 |
a--aatggtggaaccccttctcgaaccctgcgtatatgggagctttagtgcaccggg |
17668128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 45 - 221
Target Start/End: Complemental strand, 25249920 - 25249747
Alignment:
| Q |
45 |
atgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggt |
144 |
Q |
| |
|
|||| |||||||||||| | || |||||||||||||||||||| |||| |||||||||||||||||| | ||||||| ||||||||| | ||||||||| |
|
|
| T |
25249920 |
atgatgggtaaccttggcgcaattggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcatggaaacagtctcttgtgt-acaaacagggt |
25249822 |
T |
 |
| Q |
145 |
aaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||| |||||||||||| |||||||||| |||||||| |||| || |||||| |||||||||||||||||| |
|
|
| T |
25249821 |
aaggctgcgtacaatacacca--aatggtgggatcccttcccgaaccctgcgtatgcgtgagctttagtgcaccggg |
25249747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 68 - 221
Target Start/End: Complemental strand, 40417031 - 40416880
Alignment:
| Q |
68 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaat |
167 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| | |||||||||||||||| |||||||||||| ||||||| |||||||||||||| |
|
|
| T |
40417031 |
tggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcatggaaacaacctcttgtataaaaaacagggaaaggctgtgtacaatacaccaat |
40416932 |
T |
 |
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|| |||||||| || ||||| ||||||||| |||||||||||||||||| |
|
|
| T |
40416931 |
--tgatgggacccttttttggaccctgcatatgcgagagctttagtgcaccggg |
40416880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 65 - 217
Target Start/End: Original strand, 17623536 - 17623686
Alignment:
| Q |
65 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
164 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
17623536 |
aactggtaaagttgttgtcatgcgactggaaggtcacgggttcaagtcctcgaaacaacctcttgtgtaaaaatcagggtaaggctgcgtacaatacacc |
17623635 |
T |
 |
| Q |
165 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
| |||||||| |||||||||| | || || |||| || ||||||||||||| |
|
|
| T |
17623636 |
a--aatggtggaaccccttcccgaatcctgcgtatgtggaagctttagtgcac |
17623686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 67 - 221
Target Start/End: Complemental strand, 39914467 - 39914315
Alignment:
| Q |
67 |
ctggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaa-aaaacagggtaaggctgcatacaatacacca |
165 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||| |||||||||||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
39914467 |
ctggtaaagttgttgtcatgtgactggaaggtcacgggatcaagtactggaaacaacctcttgtgtaaaaaaacagggtaaggatgtgtacaatacacc- |
39914369 |
T |
 |
| Q |
166 |
ataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||| || ||||| || |||||||||||||||||||| |||| |
|
|
| T |
39914368 |
-gaatggtgggacccctt-cctgaccctgcgtatgcgggagctttagtgcatcggg |
39914315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 84 - 221
Target Start/End: Original strand, 10546153 - 10546289
Alignment:
| Q |
84 |
atgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaa-cagggtaaggctgcatacaatacaccaataatggtgggacccct |
182 |
Q |
| |
|
|||| |||| |||||||||||||||||| ||||||| |||||||| ||||||| |||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
10546153 |
atgtgactgaaaggtcacgggttcaagtcctggaaacatcctcttgtataaaaaaacagggtaaggctgcgtacaatacaccaa--atggtgggacccct |
10546250 |
T |
 |
| Q |
183 |
tcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
10546251 |
tcccggaccctgcgtatgcgggagctttagtgcaccggg |
10546289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 44 - 192
Target Start/End: Original strand, 22371008 - 22371151
Alignment:
| Q |
44 |
aatgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacaggg |
143 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||| |||| ||| |||||||||| |
|
|
| T |
22371008 |
aatgaggggtaaccttggcccaactggtaaagttgttgtcatgtgactgggaggtcacgggttcaagtcctggaaacagcctcgtgt---aaaaacaggg |
22371104 |
T |
 |
| Q |
144 |
taaggctgcatacaatacaccaataatggtgggaccccttcccagaccc |
192 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
22371105 |
taaggctgcgtacaatacacca--aatggtgggaccccttcccggaccc |
22371151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 71 - 218
Target Start/End: Complemental strand, 31158598 - 31158451
Alignment:
| Q |
71 |
taaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataat |
170 |
Q |
| |
|
||||||||||||||||| |||| ||||||| ||||| |||| ||||| ||||||| ||||||||||||||||| ||||||||||| ||||| ||| |
|
|
| T |
31158598 |
taaagttgttgtcatgtgactgaaaggtcaagggttaaagtcttcaaaacagcctcttgcgtaaaaaacagggtaagattgcatacaataaaccaaaaat |
31158499 |
T |
 |
| Q |
171 |
ggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||| |||| |
|
|
| T |
31158498 |
ggtgggaccccttcccagaccctgcgtatgcgggagctttagtacacc |
31158451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 68 - 210
Target Start/End: Complemental strand, 32781448 - 32781308
Alignment:
| Q |
68 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaat |
167 |
Q |
| |
|
|||||||||||||| |||| ||| ||||||||| |||||||| ||||||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
32781448 |
tggtaaagttgttgcaatgttgctgaaaggtcacgagttcaagtctcggaaacaacctcttgtgtaaaaaacagggtaagactgcgtacaatacacca-- |
32781351 |
T |
 |
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagcttt |
210 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
32781350 |
aatggtgggaccccttcccagaccctgtgtatgcgggagcttt |
32781308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 49 - 216
Target Start/End: Original strand, 17896215 - 17896381
Alignment:
| Q |
49 |
ggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgt-aaaaaacagggtaag |
147 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||| || | |||||||||| ||||||| ||||||||||||||||| |||||| |||||||| |
|
|
| T |
17896215 |
ggggtaaccttgacgcaactggtaaagttgttgtcatgtgaccgaaaggtcacggattcaagtcctagaaacaacctcttgtgtaaaaaaatagggtaag |
17896314 |
T |
 |
| Q |
148 |
gctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
216 |
Q |
| |
|
||||| ||||||| |||| ||||||||||||||||| | ||||| || |||| ||||||||||||||| |
|
|
| T |
17896315 |
gctgcgtacaatatacca--aatggtgggaccccttctcggaccctgcgtatgtgggagctttagtgca |
17896381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 47 - 218
Target Start/End: Original strand, 7214488 - 7214659
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||| |||| ||||||| |||||||||| ||||||| ||||||||||||| ||||||||| |
|
|
| T |
7214488 |
gaggggtaactttggcacaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcttggaaacagtctcttgtgtaaaatacagggtaa |
7214587 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
|||||| |||||||||| || ||||||| || |||||| | ||| | || |||||| ||| ||||||||||| |
|
|
| T |
7214588 |
ggctgcgtacaatacacaaaaaatggtgagatcccttctcggacactgcgtatgcgagagttttagtgcacc |
7214659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 84 - 218
Target Start/End: Original strand, 14444720 - 14444851
Alignment:
| Q |
84 |
atgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggacccctt |
183 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||| ||||||||||||||| ||||||||||||| ||| ||||||||| ||||||||||||||| |
|
|
| T |
14444720 |
atgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaa-cagggtaaggctgtgtacgatacaccaa--atggtgggacccctt |
14444816 |
T |
 |
| Q |
184 |
cccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
||| ||||| || |||||||||||||||||||||| |
|
|
| T |
14444817 |
cccggaccctgcgtatgcgggagctttagtgcacc |
14444851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 47 - 165
Target Start/End: Original strand, 17705449 - 17705567
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| ||| ||||||||||||||||||| |||||| ||||||||||||| ||||| |||| |
|
|
| T |
17705449 |
gaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactagaaggtcacgggttcaagtcctggaaaccgcctcttgtgtaaacaacagagtaa |
17705548 |
T |
 |
| Q |
147 |
ggctgcatacaatacacca |
165 |
Q |
| |
|
||||| |||||||||||| |
|
|
| T |
17705549 |
ggctgtgtacaatacacca |
17705567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 49 - 218
Target Start/End: Complemental strand, 19977893 - 19977726
Alignment:
| Q |
49 |
ggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaagg |
148 |
Q |
| |
|
||||||||||||| | ||||||| ||||||||||||||| || | |||||||||||||||||| ||||||| |||||| ||||||||| ||| ||||| |
|
|
| T |
19977893 |
ggggtaaccttggcggaactggtgaagttgttgtcatgtgaccgaaaggtcacgggttcaagttctggaaacagcctcttttgtaaaaaataggataagg |
19977794 |
T |
 |
| Q |
149 |
ctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
||| |||||||||||| |||||||||| |||||||| ||| | |||||||||||||||||||||| |
|
|
| T |
19977793 |
ttgcgtacaatacacca--aatggtgggatcccttcccgaaccttgtgtatgcgggagctttagtgcacc |
19977726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 69 - 210
Target Start/End: Original strand, 33795261 - 33795400
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatac-aatacaccaat |
167 |
Q |
| |
|
|||||||||||||||| || | || |||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| ||| |||||||| |
|
|
| T |
33795261 |
ggtaaagttgttgtcacgtgattgaaaggtcacgggttcaagtcccggaaacaacctcttgggtaaaaaacagggtaaggctgcgtacaaatacacc--- |
33795357 |
T |
 |
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagcttt |
210 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
33795358 |
tatggtgggaccccttcccagaccctgtgtatgcgggagcttt |
33795400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 69 - 219
Target Start/End: Complemental strand, 21377232 - 21377085
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
||||||||||||||||||| |||| ||||| ||| |||||||| | |||||| ||||||||||||||||||||||||||||| |||||| ||||| | |
|
|
| T |
21377232 |
ggtaaagttgttgtcatgtgactgaaaggttacgagttcaagtcatagaaacatcctcttgtgtaaaaaacagggtaaggctgggtacaatgcacca--a |
21377135 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
219 |
Q |
| |
|
|||||||||||||||||| |||| || |||| ||||||||| |||||||| |
|
|
| T |
21377134 |
atggtgggaccccttcccgaaccctgcgtatgtgggagcttt-gtgcaccg |
21377085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 48 - 218
Target Start/End: Original strand, 14544018 - 14544189
Alignment:
| Q |
48 |
aggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgta-aaaaacagggtaa |
146 |
Q |
| |
|
|||||||||||||| | || |||||||||||||||||||| |||| ||||| || ||| || || ||||||| ||||||||||| ||||||||||||| |
|
|
| T |
14544018 |
aggggtaaccttggcgcaattggtaaagttgttgtcatgtgactgaaaggttacaggtccaggtactggaaacagcctcttgtgtagaaaaacagggtaa |
14544117 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
| |||| | ||||| | || |||||| ||||||||||| ||||| || |||||||||||||||||||||| |
|
|
| T |
14544118 |
gactgcgtgcaataaccaaaaaatggtcggaccccttccgggaccctgcgtatgcgggagctttagtgcacc |
14544189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 69 - 221
Target Start/End: Complemental strand, 4516510 - 4516360
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
|||||||||||||||| || |||| |||||||| ||||||| |||||| ||||||||||||||||||||| || ||||| |||||||||||||| |
|
|
| T |
4516510 |
ggtaaagttgttgtcacgtgactgaaaggtcacatattcaagttctagaaacagcctcttgtgtaaaaaacagggcaacgctgcgtacaatacaccaat- |
4516412 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||||||||| ||||| || |||| || |||||||||| |||||| |
|
|
| T |
4516411 |
-tggtgggaccccttcccggaccctgcgtatgtggaagctttagtgtaccggg |
4516360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 53 - 221
Target Start/End: Original strand, 27573581 - 27573746
Alignment:
| Q |
53 |
taaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgc |
152 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||| |||| ||||||| ||||||||| ||| |||| |||||||||| | ||||| ||||||||||| |
|
|
| T |
27573581 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcattggttcaagtccgggcaacagcctcttgtgt-ataaacatggtaaggctgc |
27573679 |
T |
 |
| Q |
153 |
atacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||| |||| | |||| ||||||||||||||| |||| |
|
|
| T |
27573680 |
gtacaatacacca--aatggtggaaccatttcccaaaccctgtgtatgtgggagctttagtgcatcggg |
27573746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 71 - 185
Target Start/End: Original strand, 5450263 - 5450376
Alignment:
| Q |
71 |
taaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgt-aaaaaacagggtaaggctgcatacaatacaccaataa |
169 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||| | |||||||||||||||||| |||||||| ||||||||||| |||||||||||| || |
|
|
| T |
5450263 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaattcctggaaacaacctcttgtgtaaaaaaacatggtaaggctgcgtacaatacacca--aa |
5450360 |
T |
 |
| Q |
170 |
tggtgggaccccttcc |
185 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
5450361 |
gggtgggaccccttcc |
5450376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 82 - 218
Target Start/End: Original strand, 19614981 - 19615116
Alignment:
| Q |
82 |
tcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggacccc |
181 |
Q |
| |
|
|||||| |||| |||||||||||||||||| |||||| |||||||| |||||||||||||||| |||| ||||||| ||||||||| || ||||||| |
|
|
| T |
19614981 |
tcatgtgactgaaaggtcacgggttcaagtccttgaaacatcctcttgtataaaaaacagggtaagactgcgtacaatataccaataatagt-ggacccc |
19615079 |
T |
 |
| Q |
182 |
ttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
||||| |||| || ||||| |||||||||||||||| |
|
|
| T |
19615080 |
ttcccgaaccctgcgtatgcaggagctttagtgcacc |
19615116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 65 - 220
Target Start/End: Complemental strand, 24860149 - 24859998
Alignment:
| Q |
65 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
164 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||| ||||||| ||| ||||||||||||| |||| ||||||| ||| ||||||| ||||||||||| |
|
|
| T |
24860149 |
aactggtaaaattgttgtcatgtgactggaaggttacgggtttaagccctggaaacaacctctggtgt-aaaaacatggt-aggctgcgtacaatacacc |
24860052 |
T |
 |
| Q |
165 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
| |||||| | |||||||| | ||||| || |||||||||||||||||||||||| |
|
|
| T |
24860051 |
a--aatggtagaaccccttctcggaccctgcgtatgcgggagctttagtgcaccgg |
24859998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 69 - 211
Target Start/End: Complemental strand, 44521532 - 44521392
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
|||||||||||| ||| || |||| ||||||||| |||||| | |||||||| ||||||||||||||||| |||||||||||||| ||||||||| | |
|
|
| T |
44521532 |
ggtaaagttgttatcacgtgactgaaaggtcacgcgttcaaatcttggaaacaatctcttgtgtaaaaaacaaggtaaggctgcatataatacacca--a |
44521435 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagcttta |
211 |
Q |
| |
|
|||| |||| |||||||||||| |||||| ||||||||||| |
|
|
| T |
44521434 |
atggcgggagcccttcccagacattgcatatacgggagcttta |
44521392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 70 - 214
Target Start/End: Complemental strand, 99421 - 99281
Alignment:
| Q |
70 |
gtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataa |
169 |
Q |
| |
|
||||||||||||||| || |||| |||||||||||||||||| |||||| ||||| ||||||||||| || |||||||| |||||||||||| || |
|
|
| T |
99421 |
gtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctagaaacagcctct--tgtaaaaaacatggcaaggctgcgtacaatacacca--aa |
99326 |
T |
 |
| Q |
170 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
|||||| |||||||| ||||||| | |||||||||||||||||| |
|
|
| T |
99325 |
tggtggaaccccttctcagaccctgtgtatgcgggagctttagtg |
99281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 115 - 221
Target Start/End: Original strand, 36871515 - 36871617
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
||||||| |||||||||| |||| |||||||||||||| |||||||||||| ||||||||||||||||||| || || || |||||||||||||||||| |
|
|
| T |
36871515 |
ggaaacagcctcttgtgtgaaaa-cagggtaaggctgcgtacaatacacca--aatggtgggaccccttcccgga-cctgcgtatgcgggagctttagtg |
36871610 |
T |
 |
| Q |
215 |
caccggg |
221 |
Q |
| |
|
||||||| |
|
|
| T |
36871611 |
caccggg |
36871617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 115 - 221
Target Start/End: Complemental strand, 40762347 - 40762243
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||| | |||||||||||| ||||||||||||| |||| ||||| || |||| ||||||||||||| |
|
|
| T |
40762347 |
ggaaacagcctcttgtgtaaaaaactgggtaaggctacgtacaatacacca--aatggtgggaccctttcctggaccctgcgtatgtgggagctttagtg |
40762250 |
T |
 |
| Q |
215 |
caccggg |
221 |
Q |
| |
|
||||||| |
|
|
| T |
40762249 |
caccggg |
40762243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 68 - 221
Target Start/End: Original strand, 44643497 - 44643649
Alignment:
| Q |
68 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgt-aaaaaacagggtaaggctgcatacaatacaccaa |
166 |
Q |
| |
|
|||||||||||| |||||| |||| ||||||||| |||||||| |||| | |||||| || ||||||||| |||||||||| |||||| |||| |
|
|
| T |
44643497 |
tggtaaagttgtcatcatgtgactgaaaggtcacgtgttcaagttctagaaagagcctcttccgtaaaaaaacagagtaaggctgcgtacaatgtacca- |
44643595 |
T |
 |
| Q |
167 |
taatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||||| ||||||||||||| |
|
|
| T |
44643596 |
-aatggtgggaccccttcccagaccctgcgtatgcgggagccttagtgcaccggg |
44643649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 133 - 217
Target Start/End: Original strand, 24890451 - 24890533
Alignment:
| Q |
133 |
aaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||||||||||| |
|
|
| T |
24890451 |
aaaaaacaaggtaaggctgcatacaatacaccaat--tggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcac |
24890533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 69 - 192
Target Start/End: Complemental strand, 23145857 - 23145736
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
|||||||||||||| || |||| |||||||||||||||||| | ||||| |||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
23145857 |
ggtaaagttgttgtagcgtgactgaaaggtcacgggttcaagtcttgaaaacagactcttgtgtaaaaaacagtgtaaggctgcgtacaatacaccaat- |
23145759 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccc |
192 |
Q |
| |
|
||||||||||| ||||| ||||| |
|
|
| T |
23145758 |
-tggtgggaccctttcccggaccc |
23145736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 69 - 192
Target Start/End: Complemental strand, 23557647 - 23557526
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
|||||||||||||| || |||| |||||||||||||||||| | ||||| |||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
23557647 |
ggtaaagttgttgtagcgtgactgaaaggtcacgggttcaagtcttgaaaacagactcttgtgtaaaaaacagtgtaaggctgcgtacaatacaccaat- |
23557549 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccc |
192 |
Q |
| |
|
||||||||||| ||||| ||||| |
|
|
| T |
23557548 |
-tggtgggaccctttcccggaccc |
23557526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 64 - 147
Target Start/End: Original strand, 44604825 - 44604907
Alignment:
| Q |
64 |
taactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaag |
147 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||| ||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
44604825 |
taactgctaaagttgttgtcatgtgactggaaggtcacaggttcaagtcctggaaacaacctcttgtgt-aaaaacagggtaag |
44604907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 73 - 221
Target Start/End: Complemental strand, 17380391 - 17380247
Alignment:
| Q |
73 |
aagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatgg |
172 |
Q |
| |
|
||||||||||||||| || | |||||||||||||||||| |||||||||||||||||| | ||||||||||||| || | |||||||||| |||| |
|
|
| T |
17380391 |
aagttgttgtcatgtgaccgaaaggtcacgggttcaagtcttggaaacaacctcttgtgt-ataaacagggtaaggttgtgtgcaatacacca--aatga |
17380295 |
T |
 |
| Q |
173 |
tgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||| ||||||||| ||||| || ||||||||||||| |||||||||| |
|
|
| T |
17380294 |
tggaaccccttcctggaccctgcggatgcgggagcttt-gtgcaccggg |
17380247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 47 - 220
Target Start/End: Complemental strand, 26684803 - 26684630
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaaca-acctcttgtgtaaaaaac-agggt |
144 |
Q |
| |
|
|||||||||| || | | ||||||||||||||||||||||| | || ||||||| |||| |||| | ||||| ||||||||||||||||| | ||| |
|
|
| T |
26684803 |
gaggggtaactttagcgcaactggtaaagttgttgtcatgtgattgaaaggtcaaaggtttaagtcctgaaaacagacctcttgtgtaaaaaaatatggt |
26684704 |
T |
 |
| Q |
145 |
aaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
|||||||| ||||||| || || ||||||||||| |||||| |||| || ||||||||||||||| |||||||| |
|
|
| T |
26684703 |
aaggctgcgtacaatatactaa--atggtgggacctcttcccgaaccctgcgtatgcgggagctttaatgcaccgg |
26684630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 69 - 166
Target Start/End: Complemental strand, 29420048 - 29419947
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacaggg----taaggctgcatacaatacacc |
164 |
Q |
| |
|
|||||||||||||||| | |||| ||||||||| |||||||| ||||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
29420048 |
ggtaaagttgttgtcacatgactgaaaggtcacgagttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaagtaaggctgcgtacaatacacc |
29419949 |
T |
 |
| Q |
165 |
aa |
166 |
Q |
| |
|
|| |
|
|
| T |
29419948 |
aa |
29419947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 115 - 218
Target Start/End: Original strand, 30826059 - 30826158
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||| ||| ||||||||||||| ||||||| |||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
30826059 |
ggaaacagcctcttgtgtaaaaat-agggtaaggttgcgtacaatacaccaa--atggtggaaccc-ttcccagaccctacatatgcgggagctttagtg |
30826154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 87 - 220
Target Start/End: Original strand, 17471542 - 17471675
Alignment:
| Q |
87 |
taactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaa-cagggtaaggctgcatacaatacaccaataatggtgggaccccttcc |
185 |
Q |
| |
|
|||||| || ||||| ||||||||| |||||| |||||||||||||||| |||| |||| |||| ||||||| ||||| |||| || |||||||||| |
|
|
| T |
17471542 |
taactgaaatgtcacaggttcaagtctcagaaacagcctcttgtgtaaaaaaacaggataagactgcgtacaatataccaa-aatgatgagaccccttcc |
17471640 |
T |
 |
| Q |
186 |
cagaccccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
| ||||| || |||||||||| ||||||||||||| |
|
|
| T |
17471641 |
ctgaccctgcctatgcgggagttttagtgcaccgg |
17471675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 78 - 220
Target Start/End: Original strand, 25641487 - 25641626
Alignment:
| Q |
78 |
gttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtggga |
177 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||| ||||||| | | |||||| |||||||||||| | ||| |||||||||||| ||| |||||| |
|
|
| T |
25641487 |
gttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcattttgtgt-gaaaacagggtaaagttgcgtacaatacacca--aattgtggga |
25641583 |
T |
 |
| Q |
178 |
ccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
||||||||| | || || |||||| ||||||||||| ||||| |
|
|
| T |
25641584 |
ccccttcccgaatcctgcgtatgcgagagctttagtgaaccgg |
25641626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 128 - 221
Target Start/End: Original strand, 25632544 - 25632635
Alignment:
| Q |
128 |
tgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||| |||||||||| ||||||| ||| | ||||||||||||||||||||||||| |
|
|
| T |
25632544 |
tgtgtaaaaaacaggataaggctgcgtacaatacacca--aatggtgggattccttcccgaaccttacgtatgcgggagctttagtgcaccggg |
25632635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 156 - 221
Target Start/End: Original strand, 23488544 - 23488609
Alignment:
| Q |
156 |
caatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||| || ||||||||||||||||||| ||||| || |||||| |||||||||||||||||| |
|
|
| T |
23488544 |
caatacacaaaaaatggtgggaccccttcccggaccctgcgtatgcgagagctttagtgcaccggg |
23488609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 117 - 218
Target Start/End: Complemental strand, 44449495 - 44449395
Alignment:
| Q |
117 |
aaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
216 |
Q |
| |
|
||||||||||||| | ||||||||| ||||||||| ||||||||||||| ||| ||||||||||||||| ||||| || | || ||||| |||| |||| |
|
|
| T |
44449495 |
aaacaacctcttgaatgaaaaacaggataaggctgcgtacaatacaccaa-aatagtgggaccccttcccggaccctgcgtttgtgggagttttaatgca |
44449397 |
T |
 |
| Q |
217 |
cc |
218 |
Q |
| |
|
|| |
|
|
| T |
44449396 |
cc |
44449395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 169 - 221
Target Start/End: Original strand, 41409936 - 41409988
Alignment:
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||| ||||||||||| |
|
|
| T |
41409936 |
atggtgggaccccttcccggaccctgcatatgcgggagcttcagtgcaccggg |
41409988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 176 - 219
Target Start/End: Complemental strand, 3633762 - 3633719
Alignment:
| Q |
176 |
gaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
219 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3633762 |
gaccccttcccggaccccgcatatgcgggagctttagtgcaccg |
3633719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 170 - 221
Target Start/End: Original strand, 34080176 - 34080227
Alignment:
| Q |
170 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| |||||||||||||| |
|
|
| T |
34080176 |
tggtgggaccccttcccggaccctgcatatgcgggagttttagtgcaccggg |
34080227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 58 - 214
Target Start/End: Complemental strand, 45235988 - 45235833
Alignment:
| Q |
58 |
ttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaa-aacagggtaaggctgcatac |
156 |
Q |
| |
|
|||||||||| ||||||||||| |||||| |||| ||| ||||| |||||||| |||||| ||||| ||||||| || ||||||||||| | | |
|
|
| T |
45235988 |
ttggtgtaaccagtaaagttgttctcatgtgactgaaagatcacgagttcaagtcctagaaacagtctcttctgtaaaataatagggtaaggctacgtgt |
45235889 |
T |
 |
| Q |
157 |
aatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
||||||| || ||||||||||||||| |||||||| | ||||| |||||||||||| |
|
|
| T |
45235888 |
aatacacaaa--atggtgggaccccttaccagaccctacgtatgcaggagctttagtg |
45235833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 102 - 215
Target Start/End: Complemental strand, 15296533 - 15296421
Alignment:
| Q |
102 |
gggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgc |
201 |
Q |
| |
|
|||||||||| ||||||| ||| |||||||||| ||||||||||||||| ||||||| ||||| ||| |||||| |||||| | ||||| || |||| |
|
|
| T |
15296533 |
gggttcaagtcccggaaacagcctgttgtgtaaaatacagggtaaggctgcgtacaatataccaa-aatagtgggatcccttctcggaccctgcgtatgt |
15296435 |
T |
 |
| Q |
202 |
gggagctttagtgc |
215 |
Q |
| |
|
|| |||||| |||| |
|
|
| T |
15296434 |
ggaagctttggtgc |
15296421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 169 - 221
Target Start/End: Complemental strand, 40579810 - 40579758
Alignment:
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||||| ||||| | ||||||||||||||||||||||||| |
|
|
| T |
40579810 |
atggtgggaccccttcccggaccctgagtatgcgggagctttagtgcaccggg |
40579758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 170 - 221
Target Start/End: Original strand, 34766330 - 34766381
Alignment:
| Q |
170 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||||||||| ||||| || |||||||||||||||||||| |||| |
|
|
| T |
34766330 |
tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacggg |
34766381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 179 - 221
Target Start/End: Complemental strand, 39189555 - 39189513
Alignment:
| Q |
179 |
cccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
39189555 |
cccttcccggaccccgcatatgcgggagctctagtgcaccggg |
39189513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 46 - 92
Target Start/End: Complemental strand, 39189603 - 39189557
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactg |
92 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||| |||| |
|
|
| T |
39189603 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactg |
39189557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 142 - 214
Target Start/End: Complemental strand, 13245181 - 13245111
Alignment:
| Q |
142 |
ggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
||||||||||| |||| ||||| || |||||||||||||||||| |||| |||||| |||||||||||||| |
|
|
| T |
13245181 |
ggtaaggctgcgtacattacactaa--atggtgggaccccttcccggaccatgcatatacgggagctttagtg |
13245111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 168 - 217
Target Start/End: Original strand, 31523304 - 31523353
Alignment:
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
|||||||| |||| |||||| |||| |||||||||||||||||||||||| |
|
|
| T |
31523304 |
aatggtggaaccctttcccaaaccctgcatatgcgggagctttagtgcac |
31523353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 220
Target Start/End: Original strand, 31525779 - 31525831
Alignment:
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
|||| |||||||| || |||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
31525779 |
aatgatgggaccctttgccagaccctgcatatgcgggagctttagtgtaccgg |
31525831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 220
Target Start/End: Original strand, 1289093 - 1289148
Alignment:
| Q |
166 |
ataatggtgggaccccttcccagaccccgcatatgcgggagc-tttagtgcaccgg |
220 |
Q |
| |
|
||||||||||||||||||||| || | |||||||||||||| ||||||||||||| |
|
|
| T |
1289093 |
ataatggtgggaccccttcccggatcatgcatatgcgggagcttttagtgcaccgg |
1289148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 217
Target Start/End: Original strand, 4794875 - 4794924
Alignment:
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
|||| |||||||||||||| || || ||||||||||||||| |||||||| |
|
|
| T |
4794875 |
aatgatgggaccccttcccggatcctgcatatgcgggagctctagtgcac |
4794924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 136 - 213
Target Start/End: Complemental strand, 19185837 - 19185760
Alignment:
| Q |
136 |
aaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagt |
213 |
Q |
| |
|
||||| ||||| | ||| |||||| ||| || |||||||| ||||||||| ||||| || ||||||||||||||||| |
|
|
| T |
19185837 |
aaacatggtaaagttgcgtacaatgcacaaaaaatggtggaaccccttcctggaccctgcgtatgcgggagctttagt |
19185760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 94 - 166
Target Start/End: Complemental strand, 12315785 - 12315714
Alignment:
| Q |
94 |
aaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaa |
166 |
Q |
| |
|
||||||||| |||||||| | ||||||| | |||| | |||||||||||||||| ||| ||||||||||||| |
|
|
| T |
12315785 |
aaggtcacgagttcaagtcatggaaacagcttcttat-taaaaaacagggtaagactgtgtacaatacaccaa |
12315714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 110; Significance: 1e-55; HSPs: 57)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 65 - 221
Target Start/End: Complemental strand, 12222080 - 12221923
Alignment:
| Q |
65 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
164 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12222080 |
aactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcttggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacacc |
12221981 |
T |
 |
| Q |
165 |
aataatggtgggaccccttcccagaccccgcatatgcgggagc-tttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||||||||| ||||| || ||||||||||| |||||||||||||| |
|
|
| T |
12221980 |
aataatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccggg |
12221923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 46 - 221
Target Start/End: Complemental strand, 29356040 - 29355864
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaag-ttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggt |
144 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||| |||| |||||||||||||||||| ||||||| |||||||||||| ||||||||| |
|
|
| T |
29356040 |
tgaggggtaaccttggcacaactggtaaaaattgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaagaaacagggt |
29355941 |
T |
 |
| Q |
145 |
aaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
29355940 |
aaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggg |
29355864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 47 - 221
Target Start/End: Original strand, 1346918 - 1347088
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| || ||||||| |||||||||||| |
|
|
| T |
1346918 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagccacttgtgt--aaaacagggtaa |
1347015 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||| ||||| ||||||||||||||| |||||||||||| |
|
|
| T |
1347016 |
ggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
1347088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 47 - 221
Target Start/End: Complemental strand, 1354936 - 1354766
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||| |||| |||||||| ||||||||| ||||||| |||||||||| |||||||||||| |
|
|
| T |
1354936 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcactggttcaagtcctggaaacagcctcttgtgt--aaaacagggtaa |
1354839 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||| ||||| ||||||||||||||| |||||||||||| |
|
|
| T |
1354838 |
ggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
1354766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 65 - 221
Target Start/End: Complemental strand, 2166575 - 2166419
Alignment:
| Q |
65 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
164 |
Q |
| |
|
|||| ||||||||||||| |||| |||| |||||||||||||||||| |||||||||||||||||||||| ||||| ||||| ||| ||||||||||| |
|
|
| T |
2166575 |
aactagtaaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaatacacc |
2166476 |
T |
 |
| Q |
165 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||| ||||||||||||||||||||| |
|
|
| T |
2166475 |
aataatggtgggaccccttcccggaccctatatattcgggagctttagtgcaccggg |
2166419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 65 - 221
Target Start/End: Complemental strand, 2178208 - 2178052
Alignment:
| Q |
65 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
164 |
Q |
| |
|
|||| ||||||||||||| |||| |||| |||||||||||||||||| |||||||||||||||||||||| ||||| ||||| ||| ||||||||||| |
|
|
| T |
2178208 |
aactagtaaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaatacacc |
2178109 |
T |
 |
| Q |
165 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||| ||||||||||||||||||||| |
|
|
| T |
2178108 |
aataatggtgggaccccttcccggaccctatatattcgggagctttagtgcaccggg |
2178052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 44 - 218
Target Start/End: Original strand, 9161074 - 9161247
Alignment:
| Q |
44 |
aatgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacaggg |
143 |
Q |
| |
|
||||||||||||||||| | || ||||||||||||||||||| |||| |||||||| ||||||||| ||||||| ||||||||||||||| ||| | |
|
|
| T |
9161074 |
aatgaggggtaaccttgacgcaatcggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaa-cagag |
9161172 |
T |
 |
| Q |
144 |
taaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||| | ||||| || ||||||| |||||||||||||| |
|
|
| T |
9161173 |
taaggctgcgtacaatacatcaataatggtgggaccccttctcggaccctgcgtatgcggaagctttagtgcacc |
9161247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 41 - 221
Target Start/End: Complemental strand, 14975267 - 14975099
Alignment:
| Q |
41 |
aaaaatgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaaca |
140 |
Q |
| |
|
||||||||||| ||||||||| | ||| ||||||||||||||||||| ||||||||||||||| ||||||| ||||||| |||||||||||||||||| |
|
|
| T |
14975267 |
aaaaatgagggataaccttggcgcaaccggtaaagttgttgtcatgtgactggaaggtcacggattcaagtcctggaaacagcctcttgtgtaaaaaaca |
14975168 |
T |
 |
| Q |
141 |
gggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
14975167 |
agg------------caatacaccaataatggtgggaccccttcccgaaccccgcatatgcgggagttttagtgcaccggg |
14975099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 47 - 181
Target Start/End: Original strand, 1941809 - 1941941
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| | ||||||||||| ||| || |||| | | |||||||||||||||||||||||||||||| |
|
|
| T |
1941809 |
gaggggtaaccttggtgcaactggtaaagttgttgtcatctgactggaaggtcgcggattgaagtcatgtaaacaacctcttgtgtaaaaaacagggtaa |
1941908 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggacccc |
181 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||| |
|
|
| T |
1941909 |
ggctgcgtacaatacacc--gaatggtgggacccc |
1941941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 65 - 198
Target Start/End: Original strand, 6024205 - 6024338
Alignment:
| Q |
65 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
164 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||| ||||| | |||||| |||||||||||||||||| |||||| |||| ||||||||||| |
|
|
| T |
6024205 |
aactggtaaagttgttgtcatgtgattggaaggtcacggtttcaaatcctagaaacagcctcttgtgtaaaaaacatggtaagactgcgtacaatacacc |
6024304 |
T |
 |
| Q |
165 |
aataatggtgggaccccttcccagaccccgcata |
198 |
Q |
| |
|
||||||| ||||||| |||||| ||||||||||| |
|
|
| T |
6024305 |
aataatgatgggacctcttcccggaccccgcata |
6024338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 49 - 221
Target Start/End: Complemental strand, 3815256 - 3815086
Alignment:
| Q |
49 |
ggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaagg |
148 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||| |||| || ||||||||||||||| ||||||| || |||||||||||| | |||| | |
|
|
| T |
3815256 |
ggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaagtcctggaaacagactattgtgtaaaaaatatggtacga |
3815157 |
T |
 |
| Q |
149 |
ctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||| |||||||||||| ||||||||||||| ||||| |||| | ||||||| ||||||||||||||||| |
|
|
| T |
3815156 |
ctgcgtacaatacacca--aatggtgggaccctttcccgaaccctacgtatgcggaagctttagtgcaccggg |
3815086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 45 - 161
Target Start/End: Original strand, 8409195 - 8409311
Alignment:
| Q |
45 |
atgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggt |
144 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||| |||| |||| |||||||||| ||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
8409195 |
atgaggggtaaccttggcgcaactggtaaagttgttgtaatgtgactgaaaggtcacggattcaagtcctggaaactgcctcttgtgtaaaaaacagggt |
8409294 |
T |
 |
| Q |
145 |
aaggctgcatacaatac |
161 |
Q |
| |
|
|||||||| |||||||| |
|
|
| T |
8409295 |
aaggctgcgtacaatac |
8409311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 48 - 166
Target Start/End: Complemental strand, 13905158 - 13905041
Alignment:
| Q |
48 |
aggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaag |
147 |
Q |
| |
|
||||| |||||||| | ||| ||||||||||||||||||| |||| ||||||||||| |||||| | |||| |||||||||||||||||||||||||| |
|
|
| T |
13905158 |
agggggaaccttggcgcaac-ggtaaagttgttgtcatgtgactgaaaggtcacgggctcaagtcctgaaaacgacctcttgtgtaaaaaacagggtaag |
13905060 |
T |
 |
| Q |
148 |
gctgcatacaatacaccaa |
166 |
Q |
| |
|
|||||||||||| |||||| |
|
|
| T |
13905059 |
gctgcatacaattcaccaa |
13905041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 50 - 218
Target Start/End: Complemental strand, 32728334 - 32728169
Alignment:
| Q |
50 |
gggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggc |
149 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||| |||| |||||||| | ||||||| |||||||||||||| |||||||||||||||||| | |
|
|
| T |
32728334 |
gggtaaccttggtggaacgagtaaagttgttgtcatgtgactgaaaggtcacagattcaagttttggaaacaacctcttatgtaaaaaacagggtaagac |
32728235 |
T |
 |
| Q |
150 |
tgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
|| ||||||| ||||| || |||| ||| ||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
32728234 |
tgtgtacaatataccaa--atagtggt-ccctttcccagaccctacgtatgcgggaactttagtgcacc |
32728169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 89 - 217
Target Start/End: Complemental strand, 7947511 - 7947384
Alignment:
| Q |
89 |
actggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccag |
188 |
Q |
| |
|
|||| |||||||| ||||||| | |||||||||||| |||||||||| |||||||||||||| ||||||||||||| ||||||||| ||||||||| | |
|
|
| T |
7947511 |
actgaaaggtcaccggttcaactcctggaaacaacctcctgtgtaaaaaccagggtaaggctgcgtacaatacaccaa-aatggtgggcccccttcccgg |
7947413 |
T |
 |
| Q |
189 |
accccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
||| || |||| |||||||||||||||| |
|
|
| T |
7947412 |
accttgcgtatgtgggagctttagtgcac |
7947384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 157 - 221
Target Start/End: Original strand, 12892071 - 12892135
Alignment:
| Q |
157 |
aatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12892071 |
aatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccggg |
12892135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 51 - 163
Target Start/End: Original strand, 20400625 - 20400737
Alignment:
| Q |
51 |
ggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggct |
150 |
Q |
| |
|
||||||||||| | || ||||| |||||||||||||| |||| |||||||| ||||||||| | |||||||| |||||||||||||||||||||||| || |
|
|
| T |
20400625 |
ggtaaccttggcgcaattggtatagttgttgtcatgtgactgaaaggtcacaggttcaagttatggaaacaatctcttgtgtaaaaaacagggtaagact |
20400724 |
T |
 |
| Q |
151 |
gcatacaatacac |
163 |
Q |
| |
|
|| |||| ||||| |
|
|
| T |
20400725 |
gcgtacagtacac |
20400737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 58 - 208
Target Start/End: Original strand, 14553477 - 14553626
Alignment:
| Q |
58 |
ttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcataca |
157 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||| |||||||| ||||||||| ||||| | | |||||||||||||| |||||||||||| || | |
|
|
| T |
14553477 |
ttggtgcaactggtaaagttgttgtcatgtgacta-aaggtcacaggttcaagtcctggaaatagcttcttgtgtaaaaaatagggtaaggctgtgtata |
14553575 |
T |
 |
| Q |
158 |
atacaccaataatggtgggaccccttcccagaccccgcatatgcgggagct |
208 |
Q |
| |
|
||||||||| | ||||||||||||||| |||||| | |||||||||||| |
|
|
| T |
14553576 |
atacaccaaaactggtgggaccccttcgtagaccctgtgtatgcgggagct |
14553626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 47 - 217
Target Start/End: Complemental strand, 15866218 - 15866052
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||| | || ||||||| |||||||| | ||||||| |||||| |||||||||||||||| |
|
|
| T |
15866218 |
gaggggtaaccttggcccaactggtaaagttgttggcatgtgattgaaaggtcatgggttcaattcctggaaacagcctcttaagtaaaaaacagggtaa |
15866119 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
||||| | ||||||||| ||||||||||||||||||| ||||| || | ||||||| || |||||||| |
|
|
| T |
15866118 |
agctgcgt--aatacacca--aatggtgggaccccttcccggaccctgcgtttgcgggatctatagtgcac |
15866052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 115 - 221
Target Start/End: Original strand, 26097182 - 26097284
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||| ||||||||||||| ||| ||||||||||||| ||||| ||||||||||||||| ||||| |
|
|
| T |
26097182 |
ggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atgaagggaccccttcccggaccctgcatatgcgggagctctagtg |
26097277 |
T |
 |
| Q |
215 |
caccggg |
221 |
Q |
| |
|
||||||| |
|
|
| T |
26097278 |
caccggg |
26097284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 115 - 221
Target Start/End: Original strand, 25557747 - 25557849
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||| ||||||||||||| ||| || |||||||||| ||||| ||||||||||||||| ||||| |
|
|
| T |
25557747 |
ggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atgaaggaaccccttcccggaccctgcatatgcgggagctctagtg |
25557842 |
T |
 |
| Q |
215 |
caccggg |
221 |
Q |
| |
|
||||||| |
|
|
| T |
25557843 |
caccggg |
25557849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 69 - 220
Target Start/End: Complemental strand, 2755583 - 2755430
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
||||||||||||||||||| |||| |||||| ||||||||| | ||||| |||||| | ||||| ||| ||||||||| ||||||||||||| | |
|
|
| T |
2755583 |
ggtaaagttgttgtcatgtgactgaaaggtcgtaggttcaagtcttgcaaacatcctcttataccaaaaataggctaaggctgcgtacaatacaccaaaa |
2755484 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccccgcatat--gcgggagctttagtgcaccgg |
220 |
Q |
| |
|
||||||||| |||||||| | || |||||| ||||||||||||||||||||| |
|
|
| T |
2755483 |
atggtgggagtccttcccaaatcctgcatatgcgcgggagctttagtgcaccgg |
2755430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 123 - 221
Target Start/End: Original strand, 19340858 - 19340954
Alignment:
| Q |
123 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||||||| |||| ||||||||||||| ||||| || ||||||| |||||||||||| |||| |
|
|
| T |
19340858 |
cctcttgtgtaaaaaacagggtaaggttgca-acaatacaccaa-aatgatgggaccccttcctggacccggcgtatgcggaagctttagtgcaacggg |
19340954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 98 - 219
Target Start/End: Original strand, 33138838 - 33138957
Alignment:
| Q |
98 |
tcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcat |
197 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||| ||||||| || |||||||||||| ||||||||||||| || || ||||| | | |
|
|
| T |
33138838 |
tcacgggttcaagtcctggaaacaacctcttgtataaaaaacagagtaaggccgcgtacaatacacca--aatggtgggacccttttccggaccctgtgt |
33138935 |
T |
 |
| Q |
198 |
atgcgggagctttagtgcaccg |
219 |
Q |
| |
|
|||| | ||||||||||||||| |
|
|
| T |
33138936 |
atgcagtagctttagtgcaccg |
33138957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 65 - 214
Target Start/End: Original strand, 24097553 - 24097696
Alignment:
| Q |
65 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
164 |
Q |
| |
|
|||||||||| ||| |||||||| |||| ||||||||| ||| |||| ||| || |||||||| ||||||||||||||||||||| |||| ||| |
|
|
| T |
24097553 |
aactggtaaaattgatgtcatgttactgaaaggtcacgagtttaagtcctcgaaccagcctcttgtataaaaaacagggtaaggctgcttaca----acc |
24097648 |
T |
 |
| Q |
165 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
| ||||||||||||||||||| ||||| || ||||||| |||||||||| |
|
|
| T |
24097649 |
a--aatggtgggaccccttcccggaccctgcgtatgcggaagctttagtg |
24097696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 149 - 221
Target Start/End: Original strand, 12885967 - 12886039
Alignment:
| Q |
149 |
ctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||| |||||||||| || ||||||||||||||||||||||||| || |||| |||||||||||||||||||| |
|
|
| T |
12885967 |
ctgcgtacaatacacaaaaaatggtgggaccccttcccagaccctgcgtatgtgggagctttagtgcaccggg |
12886039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 69 - 221
Target Start/End: Original strand, 12889402 - 12889553
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
|||||||||||||||| || | || |||||||| ||||||||| | ||||| |||||||||| |||||||||| |||||||||||||||||||| | | |
|
|
| T |
12889402 |
ggtaaagttgttgtcacgtgagtgaaaggtcacaggttcaagtcttgaaaacagcctcttgtgttaaaaacagggcaaggctgcatacaatacaccta-a |
12889500 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
| | ||||||||||| || ||||| | || ||||||||||||||| |||| |
|
|
| T |
12889501 |
acgatgggacccctttccggaccctctgtgtgtgggagctttagtgcatcggg |
12889553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 94 - 221
Target Start/End: Complemental strand, 18277327 - 18277202
Alignment:
| Q |
94 |
aaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagacccc |
193 |
Q |
| |
|
|||||||||||||||| | ||||||| ||||||||||||||| |||||||||| || |||| |||||| |||||||||||||||||| |||| | |
|
|
| T |
18277327 |
aaggtcacgggttcaaatcttggaaacagcctcttgtgtaaaaatcagggtaaggttgagtacagaacacca--aatggtgggaccccttcctagactct |
18277230 |
T |
 |
| Q |
194 |
gcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
| ||||||||||||||| ||||||||| |
|
|
| T |
18277229 |
acgtatgcgggagctttactgcaccggg |
18277202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 71 - 220
Target Start/End: Original strand, 28007604 - 28007750
Alignment:
| Q |
71 |
taaagttgttgtcatgtaactggaa--ggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
||||||||||||||||| || ||| |||||||||||||||| ||||| | |||||||||||||| |||||| ||||||| |||||||||||| | |
|
|
| T |
28007604 |
taaagttgttgtcatgtgacatgaaaaggtcacgggttcaagtcctggaaagagcctcttgtgtaaaa--cagggtcaggctgcgtacaatacacca--a |
28007699 |
T |
 |
| Q |
169 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
||| |||||||||||||| ||| | ||||||||| |||| ||||||||||| |
|
|
| T |
28007700 |
atgctgggaccccttccctaacctc-catatgcggaagctctagtgcaccgg |
28007750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 46 - 158
Target Start/End: Original strand, 22967124 - 22967235
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
|||||||||||||| | | | ||| ||||||| ||||||||| |||| |||||||| |||||||| | ||||||||| |||||||| ||||| ||| || |
|
|
| T |
22967124 |
tgaggggtaaccttcgcgcatctgataaagttattgtcatgtgactgtaaggtcactagttcaagtcatggaaacaacttcttgtgt-aaaaataggata |
22967222 |
T |
 |
| Q |
146 |
aggctgcatacaa |
158 |
Q |
| |
|
||||||||||||| |
|
|
| T |
22967223 |
aggctgcatacaa |
22967235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 46 - 158
Target Start/End: Complemental strand, 23821269 - 23821158
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
145 |
Q |
| |
|
|||||||||||||| | | | ||| ||||||| ||||||||| |||| |||||||| |||||||| | ||||||||| ||||||||| |||| ||| || |
|
|
| T |
23821269 |
tgaggggtaaccttcgcgcatctgataaagttattgtcatgtgactgtaaggtcactagttcaagtcatggaaacaacttcttgtgta-aaaataggata |
23821171 |
T |
 |
| Q |
146 |
aggctgcatacaa |
158 |
Q |
| |
|
||||||||||||| |
|
|
| T |
23821170 |
aggctgcatacaa |
23821158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 142 - 213
Target Start/End: Original strand, 32579474 - 32579543
Alignment:
| Q |
142 |
ggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagt |
213 |
Q |
| |
|
|||||| |||| |||||||| |||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32579474 |
ggtaagcctgcgtacaataccccaa--atggtgggaccccttcccagaccctgcatatgcgggagctttagt |
32579543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 51 - 219
Target Start/End: Complemental strand, 23930303 - 23930138
Alignment:
| Q |
51 |
ggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttc-aagtgagggaaacaacctcttgtgtaaaaaacagggtaaggc |
149 |
Q |
| |
|
||||||||||| | |||| ||||| ||||||||||| || ||||||||| |||| |||| | ||||||| ||| ||||||||||||| | || | |
|
|
| T |
23930303 |
ggtaaccttggcgcaactcataaagatgttgtcatgtgtctcaaaggtcacgagttccaagtcatggaaacagtctcatgtgtaaaaaacaagata--gt |
23930206 |
T |
 |
| Q |
150 |
tgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
219 |
Q |
| |
|
||| |||||||||||| |||||||||||||||| | ||||| || ||||||||||||||||||||||| |
|
|
| T |
23930205 |
tgcgtacaatacaccag--atggtgggaccccttcacggaccctgcttatgcgggagctttagtgcaccg |
23930138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 51 - 212
Target Start/End: Original strand, 24734591 - 24734760
Alignment:
| Q |
51 |
ggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaa---------aacag |
141 |
Q |
| |
|
|||||| |||| | ||||||||||||||||||||||| |||| ||||||| |||||| | ||||||||||||||||||||| ||||| |
|
|
| T |
24734591 |
ggtaacattggcgcaactggtaaagttgttgtcatgtgactgaaaggtcaaaagttcaaatccttgaaacaacctcttgtgtaaaaaaaaaaaaaaacag |
24734690 |
T |
 |
| Q |
142 |
ggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttag |
212 |
Q |
| |
|
||||||| ||| ||||||||| ||| || |||||||||||||||| || || || ||||| |||||||||| |
|
|
| T |
24734691 |
ggtaaggttgcgtacaatacaacaaaaaaggtgggaccccttcccggatcctgcgtatgc-ggagctttag |
24734760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 117 - 221
Target Start/End: Complemental strand, 9671196 - 9671093
Alignment:
| Q |
117 |
aaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
216 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||| |||| ||| |||||| ||||||||| || |||| ||| || ||||||||||| |||| |
|
|
| T |
9671196 |
aaacagcctcttgtgtaaaaaacagggtaaggctgcctactttacatcaa-aatggtaggacccctttccgaaccctgcaaatacgggagctttaatgca |
9671098 |
T |
 |
| Q |
217 |
ccggg |
221 |
Q |
| |
|
|||| |
|
|
| T |
9671097 |
tcggg |
9671093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 115 - 186
Target Start/End: Original strand, 11849075 - 11849145
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttccc |
186 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||| | ||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
11849075 |
ggaaacaacctcttgtgttaaaaacaggataaagttgcccacaatacaccaa-aatggtgggaccccttccc |
11849145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 89 - 221
Target Start/End: Original strand, 17432336 - 17432474
Alignment:
| Q |
89 |
actggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaac------agggtaaggctgcatacaatacaccaataatggtgggacccct |
182 |
Q |
| |
|
|||| |||||||| ||||||||| ||||||||| ||||||||||||||| |||||||||||| |||||||||| || ||||||| |||| | |
|
|
| T |
17432336 |
actgaaaggtcacaggttcaagtcctggaaacaacatcttgtgtaaaaaacagggtaagggtaaggctgtgtacaatacactaaaaatggtgagaccttt |
17432435 |
T |
 |
| Q |
183 |
tcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||| || || | |||||||||||||||||||||||| |
|
|
| T |
17432436 |
tcccggatcctgtgcatgcgggagctttagtgcaccggg |
17432474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 175 - 214
Target Start/End: Complemental strand, 20906841 - 20906802
Alignment:
| Q |
175 |
ggaccccttcccagaccccgcatatgcgggagctttagtg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20906841 |
ggaccccttcccagaccccgcatatgcgggagctttagtg |
20906802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 89 - 220
Target Start/End: Complemental strand, 3116262 - 3116139
Alignment:
| Q |
89 |
actggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccag |
188 |
Q |
| |
|
|||| ||||||| |||||||||| | |||||||||||||||| |||||| | |||| |||||||||||| ||||||||||||||||| | | |
|
|
| T |
3116262 |
actgaaaggtcatgggttcaagtcatggaaacaacctcttgtataaaaatga--------ctgcgcacaatacaccaaaaatggtgggaccccttctcgg |
3116171 |
T |
 |
| Q |
189 |
accccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
||| || ||||||||||||||||| |||||| |
|
|
| T |
3116170 |
accttgcgtatgcgggagctttagtacaccgg |
3116139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 167 - 221
Target Start/End: Original strand, 6808467 - 6808521
Alignment:
| Q |
167 |
taatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||||||||| ||||| | ||||||||||||||||||||||||| |
|
|
| T |
6808467 |
taatggtgggaccccttcccggaccctgtgtatgcgggagctttagtgcaccggg |
6808521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 121 - 183
Target Start/End: Original strand, 32068121 - 32068182
Alignment:
| Q |
121 |
aacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggacccctt |
183 |
Q |
| |
|
|||||||||||||||||||||| ||| |||| ||||||||||||| |||||||||||||||| |
|
|
| T |
32068121 |
aacctcttgtgtaaaaaacaggataatgctgtttacaatacaccaa-aatggtgggacccctt |
32068182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 50 - 111
Target Start/End: Original strand, 12063424 - 12063485
Alignment:
| Q |
50 |
gggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagt |
111 |
Q |
| |
|
|||||||||||||| ||||| |||||||||| ||||| |||| |||||||||||||||||| |
|
|
| T |
12063424 |
gggtaaccttggtgcaactgataaagttgttatcatgagactgaaaggtcacgggttcaagt |
12063485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 94 - 158
Target Start/End: Original strand, 17448325 - 17448389
Alignment:
| Q |
94 |
aaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaa |
158 |
Q |
| |
|
|||||||||||||||||| | ||||||| | |||||||||||||||||||||||||| ||||| |
|
|
| T |
17448325 |
aaggtcacgggttcaagttttgaaaacaacattttgtgtaaaaaacagggtaaggctgcgtacaa |
17448389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 79 - 217
Target Start/End: Complemental strand, 23240971 - 23240837
Alignment:
| Q |
79 |
ttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggac |
178 |
Q |
| |
|
|||||| || |||| |||||||| ||| ||||| ||||||| |||||||||| ||||||||||||| ||| ||||||| |||||| ||||||||| |
|
|
| T |
23240971 |
ttgtcacgtgactgaaaggtcacaggtgcaagtcctggaaacagcctcttgtgt--aaaacagggtaagtttgcgtacaatataccaat--tggtgggac |
23240876 |
T |
 |
| Q |
179 |
cccttcccagaccccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
|||||| ||| || ||||||||||||||||||||| |
|
|
| T |
23240875 |
cccttctaggacaatgcgtatgcgggagctttagtgcac |
23240837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 156 - 221
Target Start/End: Original strand, 13267788 - 13267851
Alignment:
| Q |
156 |
caatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||| || ||||||||||||| ||||||||||| |
|
|
| T |
13267788 |
caatacaccaa--atggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccggg |
13267851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 221
Target Start/End: Complemental strand, 383834 - 383769
Alignment:
| Q |
154 |
tacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||||| || ||||||||||||| ||||||| || ||||||||||||| ||| ||||||| |
|
|
| T |
383834 |
tacaatacaccaa--attgtgggaccccttctcagaccctgcgtatgcgggagcttcagtccaccggg |
383769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 150 - 221
Target Start/End: Complemental strand, 16895778 - 16895706
Alignment:
| Q |
150 |
tgcatacaatacaccaataatggtggga-ccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||||||||||| || |||||||||| ||||||||| ||||| |||||| || || |||||||||||||| |
|
|
| T |
16895778 |
tgcatacaatacactaaaaatggtgggacccccttcccggaccctacatatgtggaagttttagtgcaccggg |
16895706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 153 - 220
Target Start/End: Complemental strand, 16916064 - 16915996
Alignment:
| Q |
153 |
atacaatacaccaataatggtgggacc-ccttcccagaccccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
||||||||||| || |||||| ||||| |||||| |||||| |||||| ||||||||||||||||||| |
|
|
| T |
16916064 |
atacaatacactaaaaatggtaggacctccttcctagaccctacatatgtgggagctttagtgcaccgg |
16915996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 115 - 183
Target Start/End: Original strand, 31990096 - 31990163
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggacccctt |
183 |
Q |
| |
|
|||||||| |||||||||||||||| | | ||| ||||||||||||||||| ||||| |||||||||| |
|
|
| T |
31990096 |
ggaaacaatctcttgtgtaaaaaacggagcaagcttgcatacaatacaccaa-aatggcgggacccctt |
31990163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 111
Target Start/End: Complemental strand, 33923009 - 33922945
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagt |
111 |
Q |
| |
|
||||||||||||||| | ||| ||||||||||||||||| | |||| || ||||| ||||||||| |
|
|
| T |
33923009 |
gaggggtaaccttggcgcaaccggtaaagttgttgtcatttgactgaaaagtcacaggttcaagt |
33922945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 221
Target Start/End: Complemental strand, 10734965 - 10734914
Alignment:
| Q |
170 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||| ||||||||| ||||| || ||||||||||||||||| ||||||| |
|
|
| T |
10734965 |
tggtgggcccccttcccggaccctgcgtatgcgggagctttagtccaccggg |
10734914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 220
Target Start/End: Original strand, 11395836 - 11395886
Alignment:
| Q |
170 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
||||||||||||||||| || || || ||||||||||||||||| |||||| |
|
|
| T |
11395836 |
tggtgggaccccttcccggatcctgcgtatgcgggagctttagtccaccgg |
11395886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 126 - 184
Target Start/End: Complemental strand, 24751176 - 24751119
Alignment:
| Q |
126 |
cttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttc |
184 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||| || ||||||| ||||||||| |
|
|
| T |
24751176 |
cttgtgtaaaaaatagggtaagactgcgtacaatacactaa-aatggtgagaccccttc |
24751119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 121
Target Start/End: Original strand, 8417444 - 8417500
Alignment:
| Q |
65 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaaca |
121 |
Q |
| |
|
||||||||||||||||||||||| |||| || |||||| ||||| || | ||||||| |
|
|
| T |
8417444 |
aactggtaaagttgttgtcatgtgactgaaatgtcacgagttcaggtcatggaaaca |
8417500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 132 - 164
Target Start/End: Complemental strand, 14341166 - 14341134
Alignment:
| Q |
132 |
taaaaaacagggtaaggctgcatacaatacacc |
164 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
14341166 |
taaaaaacagggtaaggctgcgtacaatacacc |
14341134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 134 - 190
Target Start/End: Original strand, 18254559 - 18254613
Alignment:
| Q |
134 |
aaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagac |
190 |
Q |
| |
|
||||||||||||| |||||||||||||| |||| ||| ||||||||||||| ||||| |
|
|
| T |
18254559 |
aaaaacagggtaaagctgcatacaatac-ccaa-aatagtgggaccccttcacagac |
18254613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 211
Target Start/End: Complemental strand, 29016337 - 29016301
Alignment:
| Q |
175 |
ggaccccttcccagaccccgcatatgcgggagcttta |
211 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||| |
|
|
| T |
29016337 |
ggaccccttcccagaccctgcgtatgcgggagcttta |
29016301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 103; Significance: 2e-51; HSPs: 4)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 68 - 221
Target Start/End: Original strand, 46806 - 46957
Alignment:
| Q |
68 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaat |
167 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||| |||||||||||||||||||||||| ||||||||| ||| |||||||||||| |
|
|
| T |
46806 |
tggtaaagttgttgtcatgtgactagaaggtcacgggttcaagtgctggaaacaacctcttgtgtaaaaaatagggtaaggttgcgtacaatacacca-- |
46903 |
T |
 |
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
46904 |
aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggg |
46957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 45 - 216
Target Start/End: Complemental strand, 24950 - 24786
Alignment:
| Q |
45 |
atgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggt |
144 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||| |||| ||||||| |||||||||| | ||| |||||||||||||||||||||| |
|
|
| T |
24950 |
atgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtca-----acagcctcttgtgtaaaaaacagggt |
24856 |
T |
 |
| Q |
145 |
aaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
216 |
Q |
| |
|
|||||||| ||||| |||||| ||||||||||||||||||| |||| || |||||||||||||||||||| |
|
|
| T |
24855 |
aaggctgcgtacaacacacca--aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgca |
24786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #3
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 140 - 216
Target Start/End: Complemental strand, 46796 - 46721
Alignment:
| Q |
140 |
agggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
216 |
Q |
| |
|
||||||||| ||||||||||| ||||| ||||||||||||||||||||||||| || ||||||||||||||| |||| |
|
|
| T |
46796 |
agggtaaggatgcatacaatataccaa-aatggtgggaccccttcccagaccctgcgtatgcgggagctttaatgca |
46721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #4
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 115 - 217
Target Start/End: Original strand, 43681 - 43780
Alignment:
| Q |
115 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggacccc-ttcccagaccccgcatatgcgggagctttagt |
213 |
Q |
| |
|
||||||| | |||||||||||| || ||||||||||| |||||||||||| |||||||||||||| ||| | ||||| ||||||||||||||| |||| |
|
|
| T |
43681 |
ggaaacagcgtcttgtgtaaaa--caaggtaaggctgcgtacaatacacca--aatggtgggacccctttctcggaccctgcatatgcgggagctctagt |
43776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0311 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: scaffold0311
Description:
Target: scaffold0311; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 56 - 217
Target Start/End: Original strand, 10773 - 10932
Alignment:
| Q |
56 |
ccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcata |
155 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||||||||||||||| | ||||||||||||||||||||||||||||| |||||| | |
|
|
| T |
10773 |
ccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaaggtctgaaaacaacctcttgtgtaaaaaacagggtagggctgcgtc |
10872 |
T |
 |
| Q |
156 |
caatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
217 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||| || ||||||||||||||||||||| |
|
|
| T |
10873 |
caatacacca--aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcac |
10932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 52 - 221
Target Start/End: Original strand, 58936 - 59105
Alignment:
| Q |
52 |
gtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctg |
151 |
Q |
| |
|
|||||||||| | |||||||||| || ||||||||| |||| |||||||||||||||||| ||||||| |||||||| |||||||||||||||| ||| |
|
|
| T |
58936 |
gtaaccttggagcaactggtaaacttattgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaagactg |
59035 |
T |
 |
| Q |
152 |
catacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
| ||||||||||||| ||||||||||||||||||||||| | || |||||||||||||||||||| |||| |
|
|
| T |
59036 |
cgtacaatacaccaaaaatggtgggaccccttcccagactctgcgtatgcgggagctttagtgcatcggg |
59105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 47 - 221
Target Start/End: Original strand, 30533 - 30703
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaa |
146 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||| |||| |||||||| ||||||||| ||||||| |||||||||| ||||||||||| |
|
|
| T |
30533 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcaccggttcaagtcctggaaacagcctcttgtgt--aaaacagggtag |
30630 |
T |
 |
| Q |
147 |
ggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||| ||||| ||||||||||||||| |||||||||||| |
|
|
| T |
30631 |
ggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
30703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0258 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: scaffold0258
Description:
Target: scaffold0258; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 49 - 221
Target Start/End: Complemental strand, 13202 - 13033
Alignment:
| Q |
49 |
ggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaagg |
148 |
Q |
| |
|
||||||||||||| | ||| ||||||||||||||||||| |||| |||||||| ||||||||| ||||||| ||||||| || ||||||| ||||||| |
|
|
| T |
13202 |
ggggtaaccttggcgcaaccggtaaagttgttgtcatgtgactgaaaggtcaccggttcaagtcctggaaacagcctcttgcgt-aaaaacaaggtaagg |
13104 |
T |
 |
| Q |
149 |
ctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
| T |
13103 |
ctgcgtacaatacacc--gaatggtgggaccccttcccagaccctgcgtatgcgggggctttagtgcaccggg |
13033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1176 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: scaffold1176
Description:
Target: scaffold1176; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 68 - 218
Target Start/End: Complemental strand, 1745 - 1599
Alignment:
| Q |
68 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaat |
167 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||| |||||||||| | |||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
1745 |
tggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctgaaaacaacctcttgtgt--aaaacaggataaggctgcatacaatacacca-- |
1650 |
T |
 |
| Q |
168 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
|||| |||||||||||||| ||||| || |||||||||||||||||||||| |
|
|
| T |
1649 |
aatgatgggaccccttcccggacccggcgtatgcgggagctttagtgcacc |
1599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 78; Significance: 2e-36; HSPs: 4)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 50 - 221
Target Start/End: Complemental strand, 10226 - 10059
Alignment:
| Q |
50 |
gggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggc |
149 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||||| ||||||| ||||| | |
|
|
| T |
10226 |
gggtaaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaacagagtaagac |
10129 |
T |
 |
| Q |
150 |
tgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||| |||||||||||| ||| ||||||||||||||| ||||| |||||||| |||||| ||||||||||| |
|
|
| T |
10128 |
tgcgtacaatacacca--aatagtgggaccccttcccggaccctgcatatgcaggagctccagtgcaccggg |
10059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 50 - 221
Target Start/End: Complemental strand, 20554 - 20387
Alignment:
| Q |
50 |
gggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggc |
149 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||||| ||||||| ||||| | |
|
|
| T |
20554 |
gggtaaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaacagagtaagac |
20457 |
T |
 |
| Q |
150 |
tgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
221 |
Q |
| |
|
||| |||||||||||| ||| ||||||||||||||| ||||| |||||||| |||||| ||||||||||| |
|
|
| T |
20456 |
tgcgtacaatacacca--aatagtgggaccccttcccggaccctgcatatgcaggagctccagtgcaccggg |
20387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 46 - 111
Target Start/End: Original strand, 8898 - 8963
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagt |
111 |
Q |
| |
|
|||||||||||||||| | ||| ||| ||||||||||||||| |||| || ||||| ||||||||| |
|
|
| T |
8898 |
tgaggggtaaccttggcgcaaccggtgaagttgttgtcatgtgactgaaatgtcacaggttcaagt |
8963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 46 - 111
Target Start/End: Original strand, 19226 - 19291
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagt |
111 |
Q |
| |
|
|||||||||||||||| | ||| ||| ||||||||||||||| |||| || ||||| ||||||||| |
|
|
| T |
19226 |
tgaggggtaaccttggcgcaaccggtgaagttgttgtcatgtgactgaaatgtcacaggttcaagt |
19291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0254 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: scaffold0254
Description:
Target: scaffold0254; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 65 - 192
Target Start/End: Original strand, 4129 - 4257
Alignment:
| Q |
65 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
164 |
Q |
| |
|
|||| ||||||||||||| |||| |||| |||||||||||||||||| |||||||||||||||||||||| ||||| ||||| ||| ||||||||||| |
|
|
| T |
4129 |
aactagtaaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaatacacc |
4228 |
T |
 |
| Q |
165 |
aataa-tggtgggaccccttcccagaccc |
192 |
Q |
| |
|
||||| ||||||||||||||||| ||||| |
|
|
| T |
4229 |
aataattggtgggaccccttcccggaccc |
4257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0223 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 54 - 218
Target Start/End: Original strand, 11093 - 11252
Alignment:
| Q |
54 |
aaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgca |
153 |
Q |
| |
|
|||||||| | |||||||||||||||| | |||| |||| |||||||||||||||||| ||||||| |||||||||||||| | || ||||||||| |
|
|
| T |
11093 |
aaccttggcgcaactggtaaagttgttct-atgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacaaag--taaggctgct |
11189 |
T |
 |
| Q |
154 |
tacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
||||||||||||| |||||||||| ||||||| ||||| ||||||||||||||| ||||||||| |
|
|
| T |
11190 |
tacaatacaccaa--atggtgggacaccttcccggaccctgcatatgcgggagctctagtgcacc |
11252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 102 - 221
Target Start/End: Complemental strand, 48758 - 48643
Alignment:
| Q |
102 |
gggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgc |
201 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||| ||||| |||||||| |
|
|
| T |
48758 |
gggttcaagtggtggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgc |
48663 |
T |
 |
| Q |
202 |
gggagctttagtgcaccggg |
221 |
Q |
| |
|
||||||| |||||||||||| |
|
|
| T |
48662 |
gggagctctagtgcaccggg |
48643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 46 - 179
Target Start/End: Complemental strand, 226588 - 226456
Alignment:
| Q |
46 |
tgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgt-aaaaaacagggt |
144 |
Q |
| |
|
|||| ||||||||||| | ||||||||||||||||||||||| |||| |||||||||| ||||||| |||||| |||||||| | |||||||||||| |
|
|
| T |
226588 |
tgagtggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacggattcaagtcctagaaacagcctcttgtctaaaaaaacagggt |
226489 |
T |
 |
| Q |
145 |
aaggctgcatacaatacaccaataatggtgggacc |
179 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| |
|
|
| T |
226488 |
aaggctgcatacaatacatca--aatggtgggacc |
226456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0180 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: scaffold0180
Description:
Target: scaffold0180; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 141 - 220
Target Start/End: Complemental strand, 24220 - 24143
Alignment:
| Q |
141 |
gggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
220 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||| ||||| ||||||||||||||| ||||||||||| |
|
|
| T |
24220 |
gggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgg |
24143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 124 - 218
Target Start/End: Complemental strand, 72971 - 72879
Alignment:
| Q |
124 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
218 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||| |||||| | |||||||||| || || || |||||||||||||||||||||| |
|
|
| T |
72971 |
ctcttgtgtaaaaaacacggtaaggctgcctacaatacacca--aatggtagtaccccttcccggaacctgcgtatgcgggagctttagtgcacc |
72879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 47 - 185
Target Start/End: Complemental strand, 35200 - 35062
Alignment:
| Q |
47 |
gaggggtaaccttggtgtaactggtaaagttg-ttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgt-aaaaaacagggt |
144 |
Q |
| |
|
||||| |||| |||||| ||||||||||||| ||||||||| |||| |||||||||||||||||| | ||||| ||||||||| |||||||||| |
|
|
| T |
35200 |
gagggataactttggtgcaactggtaaagtttattgtcatgtgactgtaaggtcacgggttcaagtcctgaaaacagtctcttgtgtgtgaaaacagggt |
35101 |
T |
 |
| Q |
145 |
aaggctgcatacaatacaccaataatggtgggaccccttcc |
185 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||| |||| |
|
|
| T |
35100 |
aaggctgcgtacaatacacca--aatggtgggaccctttcc |
35062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 45 - 111
Target Start/End: Original strand, 83827 - 83893
Alignment:
| Q |
45 |
atgaggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagt |
111 |
Q |
| |
|
||||||||||||||||| | |||| |||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
83827 |
atgaggggtaaccttggcgcaactagtaaagttgttgtcatgtgactgaaaggtcacgggttcaagt |
83893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0167 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: scaffold0167
Description:
Target: scaffold0167; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 100 - 191
Target Start/End: Original strand, 23606 - 23695
Alignment:
| Q |
100 |
acgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagacc |
191 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||| ||||||| |||||| | || |||||||||||||||||||||||| |
|
|
| T |
23606 |
acgggttcaagtcttgcaaacaacctcttgtgtaaaaaacagggtgaggctgcgtacaatgtagca--aatggtgggaccccttcccagacc |
23695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 69 - 180
Target Start/End: Original strand, 32906 - 33016
Alignment:
| Q |
69 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
168 |
Q |
| |
|
|||| |||||||| || || ||| ||||||| |||||||||| | |||| |||||||| |||||||||||| ||||| ||| |||||||||||||| | |
|
|
| T |
32906 |
ggtatagttgttgccacgtgacttaaaggtcatgggttcaagtccgcgaaaaaacctcttctgtaaaaaacagagtaagactgtatacaatacaccaa-a |
33004 |
T |
 |
| Q |
169 |
atggtgggaccc |
180 |
Q |
| |
|
||||||||||| |
|
|
| T |
33005 |
ttggtgggaccc |
33016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0116 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0116
Description:
Target: scaffold0116; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 67 - 137
Target Start/End: Original strand, 8865 - 8935
Alignment:
| Q |
67 |
ctggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaa |
137 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||| ||||||| | ||||||||| ||||||||||||| |
|
|
| T |
8865 |
ctggtaaagttgttgtcatgtgactgtaaggtcacaggttcaattcctggaaacaacttcttgtgtaaaaa |
8935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0954 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0954
Description:
Target: scaffold0954; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 219
Target Start/End: Original strand, 3574 - 3668
Alignment:
| Q |
123 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
219 |
Q |
| |
|
|||||||||||||| | | ||||||||||| || |||||||| | ||| |||||||||||||| |||| || ||||||| ||||||||||||||| |
|
|
| T |
3574 |
cctcttgtgtaaaatataaggtaaggctgcgtataatacaccga--atgatgggaccccttcccgaaccctgcgtatgcggcagctttagtgcaccg |
3668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0194 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0194
Description:
Target: scaffold0194; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 48 - 111
Target Start/End: Original strand, 24619 - 24682
Alignment:
| Q |
48 |
aggggtaaccttggtgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagt |
111 |
Q |
| |
|
|||||||||||||| || || |||||||||||||| || |||| |||||||||||||||||| |
|
|
| T |
24619 |
aggggtaaccttggcacaattgataaagttgttgtcaagtgactgtaaggtcacgggttcaagt |
24682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 137
Target Start/End: Original strand, 43101 - 43173
Alignment:
| Q |
65 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaa |
137 |
Q |
| |
|
||||||||||||| ||||||||| | || ||||||||| ||||| || |||||| ||||||||||||||| |
|
|
| T |
43101 |
aactggtaaagttattgtcatgtgattgaaaggtcacgagttcaggtcctagaaacagcctcttgtgtaaaaa |
43173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University