View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16699_low_22 (Length: 210)
Name: NF16699_low_22
Description: NF16699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16699_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 46959613 - 46959427
Alignment:
| Q |
1 |
attgtccttatgatttttagaatatcattgctgatttcataattttcatcgattataatcatgtatgtcagtgacatacattcttgtcaatctcctacaa |
100 |
Q |
| |
|
|||||| ||||||||| |||||||| || ||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46959613 |
attgtctttatgatttgtagaatataatagctgatttcataattttcatcaattataatcatgt----cagtgacatacattcttgtcaatctcctacaa |
46959518 |
T |
|
| Q |
101 |
ggattcaaattaatgaactttcataatgattttaattcaactgaagannnnnnnctgtaagaatgtaataatgtcctgaattgtgatgcag |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46959517 |
ggattcaaattaatgaactttcataatgattttaattcaactgatgatttttttctgtaagaatgtaataatgtcctgaattgtgatgcag |
46959427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 65 - 147
Target Start/End: Original strand, 44522569 - 44522651
Alignment:
| Q |
65 |
atgtcagtgacatacattcttgtc-aatctcctacaaggattcaaattaatgaactttcataatgattttaattcaactgaaga |
147 |
Q |
| |
|
||||||||||||||||||| |||| ||||||| ||||||||||||||||||||| |||||| || | ||||||||||||||||| |
|
|
| T |
44522569 |
atgtcagtgacatacattcctgtcgaatctccaacaaggattcaaattaatgaagtttcatgat-aatttaattcaactgaaga |
44522651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University