View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16699_low_9 (Length: 474)
Name: NF16699_low_9
Description: NF16699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16699_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 4e-73; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 4e-73
Query Start/End: Original strand, 19 - 251
Target Start/End: Complemental strand, 38706990 - 38706765
Alignment:
| Q |
19 |
aatactggtagatagatcatggtttaggggttgatctctttgtggtctcagcggctgttggtccttactgataggagggaattgttgtggattatttggg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38706990 |
aatactggtagatagatcatggtttaggg-ttgatctctttgtggtctcagcggctgttggtccttactgataggagggaattgttgtgg---atttggg |
38706895 |
T |
|
| Q |
119 |
ttctcttagggtgggctaaggttt----ggagtctttaagttgggtgtttttgtctctaggtgtctgctttatgatgattgtatatattaggccgttctg |
214 |
Q |
| |
|
||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| | ||||||||||||||| |
|
|
| T |
38706894 |
ttcccttagggtgggctaaggtttggtcggagtctttaagttgggtgtttttgtctctaggtgcatgctttatgat-------tgtattaggccgttctg |
38706802 |
T |
|
| Q |
215 |
ttttcagctgattttgggcttggagttctggggacgt |
251 |
Q |
| |
|
||||| ||||||| ||||||||||| | ||||||||| |
|
|
| T |
38706801 |
ttttctgctgattgtgggcttggagatatggggacgt |
38706765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 325 - 400
Target Start/End: Complemental strand, 38706664 - 38706589
Alignment:
| Q |
325 |
tgctgttttattgttgtatttatgttgttccctctaggtcttggtaccttggagatctttgtttttgtatccctgt |
400 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38706664 |
tgctgttttgttgttgtatttatgctgttccctctaggtcttggtaccatggagatctttgtttttgtatccctgt |
38706589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 410 - 447
Target Start/End: Complemental strand, 38706554 - 38706517
Alignment:
| Q |
410 |
tctaattttattttggcagttaaaaagttaaaataaaa |
447 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38706554 |
tctaattttattttggcagttaaaaagttaaaataaaa |
38706517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University