View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16700_high_6 (Length: 201)
Name: NF16700_high_6
Description: NF16700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16700_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 12 - 182
Target Start/End: Complemental strand, 209647 - 209477
Alignment:
| Q |
12 |
agattatactaaacacctttttctttcctttagaataagaagcatttgtcaacaatagatcactgattcagaactatatatttgttgggtgtgtacttaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
209647 |
agattatactaaacacctttttctttcctttagaataagaagcatttgtcaacaatagatcactgattcataactatatatttgttgggtgtgtacttaa |
209548 |
T |
 |
| Q |
112 |
tctagcttagtgttttggtacaataattgggagccttggtgcaatgattggggttgtttgtatgtgataag |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
209547 |
tctagcttagtgttttggtacaataattgggagccttggtgcaatggttggggttgttgctatgtgataag |
209477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University