View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16700_low_2 (Length: 345)
Name: NF16700_low_2
Description: NF16700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16700_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 3 - 289
Target Start/End: Original strand, 44709294 - 44709580
Alignment:
| Q |
3 |
atcatccatgggttacatatccatgatactnnnnnnnccagcggtggccaaatcagagactcgatggatcactatggatcccgtagtgcgagtgatggtg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44709294 |
atcatccatgggttacatatccatgatactaaaaaaaccagcggtggccaaatcagagactcgatggatcactatggatcccgtagtgcgagtgatggtg |
44709393 |
T |
 |
| Q |
103 |
atgcaatttcaatgtttggagctagtcatgtttggatagatcatatttcaatgtggaattgtgctgatggattggttgatgccgtagcgggatcaacggc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44709394 |
atgcaatttcaatgtttggagctagtcatgtttggatagatcatatttcaatgtggaattgtgctgatggattggttgatgccgtagcgggatcaacggc |
44709493 |
T |
 |
| Q |
203 |
tattaccatttccaactgccatatgacgcgtcataatgatgtaattaacaacatctcatctacttattcttttgcttacatgcatgc |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44709494 |
tattaccatttccaactgccatatgacgcgtcataatgatgtaattaacaacatctcatctacttattcttttgcttacatgcatgc |
44709580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 92 - 184
Target Start/End: Complemental strand, 25007205 - 25007113
Alignment:
| Q |
92 |
gagtgatggtgatgcaatttcaatgtttggagctagtcatgtttggatagatcatatttcaatgtggaattgtgctgatggattggttgatgc |
184 |
Q |
| |
|
|||||||||||||| ||||| || ||||| |||||| |||||||||| |||||| |||| ||| | |||||| ||||||| ||| ||||||| |
|
|
| T |
25007205 |
gagtgatggtgatggtatttccatctttggtgctagtaatgtttggattgatcatgtttccatgagaaattgtactgatggtttgattgatgc |
25007113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University