View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16701_high_31 (Length: 253)

Name: NF16701_high_31
Description: NF16701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16701_high_31
NF16701_high_31
[»] chr3 (1 HSPs)
chr3 (187-253)||(27819750-27819816)


Alignment Details
Target: chr3 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 187 - 253
Target Start/End: Complemental strand, 27819816 - 27819750
Alignment:
187 agtaaccatgcatttcaccatcaatagatatatagatagagttgctaatttgaaaatggcttcaatc 253  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27819816 agtaaccatgcatttcaccatcaatagatatatagatagagttgctaatttgaaaatggcttcaatc 27819750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University