View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16701_high_34 (Length: 247)
Name: NF16701_high_34
Description: NF16701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16701_high_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 12 - 228
Target Start/End: Complemental strand, 27065832 - 27065616
Alignment:
| Q |
12 |
tgagatgaagcaggtttttaaggtgtccgagaattcttcgatgaacaaaatgatggtggatgcgttgagtgagtgcgagagggcgccgagtgtaggtgaa |
111 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27065832 |
tgagatgaagcaagttttcaaggtgtccgagaattcttcgatgaataagatgatggtggatgcgttgagtgagtgcgagagggcgccgagtgtaggtgaa |
27065733 |
T |
 |
| Q |
112 |
acgaagcgttgtgtgggttctcttgaggatatgattgattttgcaacttctgttttgggtcacagtgttactgttcgatccactgagaatgtaaatgggg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27065732 |
acgaagcgttgtgtgggttctcttgaggatatgattgattttgcaacttctgttttgggtcacagtgttactgttcggtccactgagaatgtaaatgggg |
27065633 |
T |
 |
| Q |
212 |
cgggcaaggatgtcatg |
228 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
27065632 |
cgggcaaggatgtcatg |
27065616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 12 - 228
Target Start/End: Complemental strand, 27079549 - 27079333
Alignment:
| Q |
12 |
tgagatgaagcaggtttttaaggtgtccgagaattcttcgatgaacaaaatgatggtggatgcgttgagtgagtgcgagagggcgccgagtgtaggtgaa |
111 |
Q |
| |
|
|||| ||||||| |||||||||||||| |||||||| |||||| | || ||||| ||||| | ||| ||||||| |||||||| |||||| | ||||| |
|
|
| T |
27079549 |
tgagttgaagcaagtttttaaggtgtctgagaattcctcgatggataagatgatagtggactcattgggtgagtgtgagagggcaccgagtatgggtgag |
27079450 |
T |
 |
| Q |
112 |
acgaagcgttgtgtgggttctcttgaggatatgattgattttgcaacttctgttttgggtcacagtgttactgttcgatccactgagaatgtaaatgggg |
211 |
Q |
| |
|
|| ||||||||||| ||||| ||||||||||||||||| ||||||||||| |||||||| || ||| ||||||||||| ||||||| ||||||||| |
|
|
| T |
27079449 |
acaaagcgttgtgttggttcacttgaggatatgattgactttgcaacttcagttttgggccatgatgtaactgttcgatcaactgagagtgtaaatggat |
27079350 |
T |
 |
| Q |
212 |
cgggcaaggatgtcatg |
228 |
Q |
| |
|
||||||| |||||||| |
|
|
| T |
27079349 |
cgggcaaaaatgtcatg |
27079333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 16 - 210
Target Start/End: Complemental strand, 27053386 - 27053192
Alignment:
| Q |
16 |
atgaagcaggtttttaaggtgtccgagaattcttcgatgaacaaaatgatggtggatgcgttgagtgagtgcgagagggcgccgagtgtaggtgaaacga |
115 |
Q |
| |
|
|||||||| ||||| |||||||| || ||||| | ||| | || ||||| ||||| | ||||||||||| || || ||||| ||| |||||| | | |
|
|
| T |
27053386 |
atgaagcaagttttcaaggtgtctgaaaattcctttatggaaaagatgatagtggactcattgagtgagtgtgaaagagcgccaagtaaaggtgagatca |
27053287 |
T |
 |
| Q |
116 |
agcgttgtgtgggttctcttgaggatatgattgattttgcaacttctgttttgggtcacagtgttactgttcgatccactgagaatgtaaatggg |
210 |
Q |
| |
|
|||||||||| ||||| |||||||| |||||||| |||||||||||| |||||||| || ||| || ||||| ||||||||||||||||||||| |
|
|
| T |
27053286 |
agcgttgtgtaggttcgcttgaggacatgattgactttgcaacttctattttgggtagcaatgtgacggttcggtccactgagaatgtaaatggg |
27053192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University