View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16701_high_36 (Length: 246)
Name: NF16701_high_36
Description: NF16701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16701_high_36 |
 |  |
|
| [»] scaffold0227 (2 HSPs) |
 |  |  |
|
| [»] scaffold0053 (1 HSPs) |
 |  |  |
|
| [»] scaffold0306 (1 HSPs) |
 |  |  |
|
| [»] scaffold0152 (1 HSPs) |
 |  |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
| [»] scaffold0021 (1 HSPs) |
 |  |  |
|
| [»] scaffold0361 (1 HSPs) |
 |  |  |
|
| [»] scaffold0027 (1 HSPs) |
 |  |  |
|
| [»] scaffold0223 (1 HSPs) |
 |  |  |
|
| [»] scaffold0122 (1 HSPs) |
 |  |  |
|
| [»] scaffold0103 (1 HSPs) |
 |  |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 16)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 24613728 - 24613970
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtcgggacgtgtcaatgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttcataga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24613728 |
attatgtgattttctcaaattattagttgtgtcgacgtgtcggaacgtgtcagtgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttcataga |
24613827 |
T |
 |
| Q |
101 |
gtactactaagtactaccccactaaaataaataaattc--tttgagaactctaataccatgtgtttctttccttattctctttctctcttctgatactgc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24613828 |
gtactactaagtactaccccactaaaataaataaattctttttgagaactctgataccatgtgtttctttccttattctctttctctcttctgatactgc |
24613927 |
T |
 |
| Q |
199 |
attacaccaccaccactcctccatcggacttccctttgcttct |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24613928 |
attacaccaccaccactcctccatcggacttcccttttcttct |
24613970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 141 - 196
Target Start/End: Complemental strand, 39655402 - 39655345
Alignment:
| Q |
141 |
tgagaactctaataccat--gtgtttctttccttattctctttctctcttctgatact |
196 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39655402 |
tgagaactctgataccacccgtgtttctttccttattctctttctctcttctaatact |
39655345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 46 - 99
Target Start/End: Original strand, 23293048 - 23293101
Alignment:
| Q |
46 |
cgtgtcaatgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttcatag |
99 |
Q |
| |
|
||||||| ||| |||||||||||| |||||| |||||||||| |||||||||| |
|
|
| T |
23293048 |
cgtgtcattgtccgtgtcgtgtccggtgtccgtgtccgtatctgtgcttcatag |
23293101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 46 - 99
Target Start/End: Original strand, 31603071 - 31603124
Alignment:
| Q |
46 |
cgtgtcaatgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttcatag |
99 |
Q |
| |
|
||||||| | |||||||||||| | ||||||||||| |||||||| |||||||| |
|
|
| T |
31603071 |
cgtgtcagtattcgtgtcgtgttcggtgtccatgtctgtatccatacttcatag |
31603124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 1074830 - 1074798
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtc |
33 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
1074830 |
attatgtgattttctcaaattattagtggtgtc |
1074798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 4383399 - 4383360
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
4383399 |
attatgtgatttt-tcaaattattagttgtatcgacgtgtc |
4383360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 11651161 - 11651201
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| | |||||||||| |||||||||||||| |
|
|
| T |
11651161 |
attatgtgatttttttaaattattagctgtgtcgacgtgtc |
11651201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 194
Target Start/End: Complemental strand, 11907085 - 11907057
Alignment:
| Q |
166 |
tttccttattctctttctctcttctgata |
194 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11907085 |
tttccttattctctttctctcttctgata |
11907057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 12895301 - 12895341
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||| |||||| |
|
|
| T |
12895301 |
attatgtgattttttcaaattattatttgtgtcggcgtgtc |
12895341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 59 - 99
Target Start/End: Complemental strand, 15029755 - 15029715
Alignment:
| Q |
59 |
gtgtcgtgtccagtgtccatgtccgtatccatgcttcatag |
99 |
Q |
| |
|
||||||||||| || ||||||||||||||| |||||||||| |
|
|
| T |
15029755 |
gtgtcgtgtccggtctccatgtccgtatccctgcttcatag |
15029715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 19482700 - 19482660
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
|||||||||| || |||||||||||||||||||| |||||| |
|
|
| T |
19482700 |
attatgtgatattttcaaattattagttgtgtcggcgtgtc |
19482660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 23293013 - 23293053
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||| |||||| |
|
|
| T |
23293013 |
attatgtgattttttcaaattattagctgtgtcggcgtgtc |
23293053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 27706204 - 27706244
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| | ||||||||| ||||||||||||||| |
|
|
| T |
27706204 |
attatgtgatttttttaaattattaattgtgtcgacgtgtc |
27706244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 36635356 - 36635316
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||||||||||||||||| |||| | |||||| |
|
|
| T |
36635356 |
attatgtgattttctcaaattattagtggtgttggcgtgtc |
36635316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 64 - 100
Target Start/End: Original strand, 46084046 - 46084082
Alignment:
| Q |
64 |
gtgtccagtgtccatgtccgtatccatgcttcataga |
100 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
46084046 |
gtgtccggtgtccgtgtccgtatccatgcttcataga |
46084082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 54580050 - 54580082
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtc |
33 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
54580050 |
attatgtgattttttcaaattattagttgtgtc |
54580082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 84; Significance: 5e-40; HSPs: 17)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 100
Target Start/End: Original strand, 29447137 - 29447236
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtcgggacgtgtcaatgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttcataga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29447137 |
attatgtgattttctcaaattattagttgtgtcgacgtgtcgggacgtgtcggtgtccgtgtcgtgtccagtgtccatgtccgtatctatgcttcataga |
29447236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 2572083 - 2572171
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtcgggacgtgtcaatgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttcatag |
99 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||||| | | ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2572083 |
attatgtgattttttcaaattattaggtgtgtcgacgtgtcggta----------tccgtgtcgtgtccagtgtccgtgtccgtatccatgcttcatag |
2572171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 158 - 241
Target Start/End: Original strand, 9107919 - 9108010
Alignment:
| Q |
158 |
tgtgtttctttccttattctctttctctcttctgatact--------gcattacaccaccaccactcctccatcggacttccctttgcttct |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || | ||||| |||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
9107919 |
tgtgtttctttccttattctctttctctcttctgattctcatacgacgtgttacatcaccaccactcctccatcagacttccctttccttct |
9108010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 46 - 99
Target Start/End: Original strand, 29510366 - 29510419
Alignment:
| Q |
46 |
cgtgtcaatgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttcatag |
99 |
Q |
| |
|
||||||| ||| |||||||||||| ||||||||||| |||||| |||||||||| |
|
|
| T |
29510366 |
cgtgtcagtgtccgtgtcgtgtccggtgtccatgtcagtatccgtgcttcatag |
29510419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 14134731 - 14134691
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14134731 |
attatgtgattttctcaaattattagtattgtcgacgtgtc |
14134691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 15816156 - 15816196
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
15816156 |
attatgtgattttttcaaattattagttgtgtcggcgtgtc |
15816196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 34897117 - 34897077
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34897117 |
attatgtgattttctcaaattattagcggtgtcgacgtgtc |
34897077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 43
Target Start/End: Original strand, 24196628 - 24196666
Alignment:
| Q |
5 |
tgtgattttctcaaattattagttgtgtcgacgtgtcgg |
43 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
24196628 |
tgtgattttttcaaattattagttgtgtcggcgtgtcgg |
24196666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 39954306 - 39954348
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtcgg |
43 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
39954306 |
attatgtgattttctcaaattattagcggtgtcggcgtgtcgg |
39954348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 48 - 101
Target Start/End: Original strand, 24413624 - 24413677
Alignment:
| Q |
48 |
tgtcaatgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttcatagag |
101 |
Q |
| |
|
||||| ||| ||||||||||| |||||| ||||||||||| |||||||||||| |
|
|
| T |
24413624 |
tgtcagtgtccgtgtcgtgtctggtgtccgtgtccgtatccgtgcttcatagag |
24413677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 98
Target Start/End: Original strand, 926850 - 926902
Alignment:
| Q |
46 |
cgtgtcaatgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttcata |
98 |
Q |
| |
|
||||||| ||| |||||||||||| |||||| ||| ||||||| ||||||||| |
|
|
| T |
926850 |
cgtgtcagtgtccgtgtcgtgtccggtgtccgtgttcgtatccgtgcttcata |
926902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 13436991 - 13437031
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||| |||||| |
|
|
| T |
13436991 |
attatgtgattttttcaaattattagctgtgtcggcgtgtc |
13437031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 13844623 - 13844663
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
13844623 |
attatgtgattttctcaaattattagcagtgtcggcgtgtc |
13844663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 22652008 - 22651968
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||| |||||| |
|
|
| T |
22652008 |
attatgtgattttttcaaattattagctgtgtcggcgtgtc |
22651968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 31236604 - 31236644
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
31236604 |
attatgtgattttctcaaattattagcagtgtcggcgtgtc |
31236644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 41
Target Start/End: Original strand, 36450785 - 36450821
Alignment:
| Q |
5 |
tgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
36450785 |
tgtgattttttcaaattattagttgtgtcggcgtgtc |
36450821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 41838150 - 41838190
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| | |||||||||| |||||||||||||| |
|
|
| T |
41838150 |
attatgtgatttttttaaattattagctgtgtcgacgtgtc |
41838190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0227 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0227
Description:
Target: scaffold0227; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 141 - 196
Target Start/End: Original strand, 15754 - 15810
Alignment:
| Q |
141 |
tgagaactctaataccatg-tgtttctttccttattctctttctctcttctgatact |
196 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15754 |
tgagaactctaataccaccatgtttctttccttattctctttctctcttctgatact |
15810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0227; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 7338 - 7378
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
7338 |
attatgtgatttttccaaattattagttgtgtcggcgtgtc |
7378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 19)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 58 - 100
Target Start/End: Original strand, 18190174 - 18190216
Alignment:
| Q |
58 |
cgtgtcgtgtccagtgtccatgtccgtatccatgcttcataga |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18190174 |
cgtgtcgtgtccggtgtccatgtccgtatccatgcttcataga |
18190216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 1262916 - 1262876
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
1262916 |
attatgtgattttctcaaattattagctgtgtcggcgtgtc |
1262876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 10572616 - 10572656
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
10572616 |
attatgtgattttctcaaattattagtggtgtcggcgtgtc |
10572656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 12443487 - 12443527
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
12443487 |
attatgtgattttctcaaattattagctgtgtcggcgtgtc |
12443527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 22881643 - 22881683
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
22881643 |
attatgtgattttttcaaattattagttgtgtcggcgtgtc |
22881683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 38078688 - 38078728
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
38078688 |
attatgtgattttttcaaattattagctgtgtcgacgtgtc |
38078728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 46 - 99
Target Start/End: Original strand, 398827 - 398880
Alignment:
| Q |
46 |
cgtgtcaatgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttcatag |
99 |
Q |
| |
|
||||||| ||| |||||||||||| |||||| |||||||||| |||||||||| |
|
|
| T |
398827 |
cgtgtcagtgtccgtgtcgtgtccggtgtccgcgtccgtatccgtgcttcatag |
398880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 9828076 - 9828035
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtcg |
42 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||| ||||||| |
|
|
| T |
9828076 |
attatgtgattttatcaaattattagtggtgtcggcgtgtcg |
9828035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 58 - 99
Target Start/End: Original strand, 10577809 - 10577850
Alignment:
| Q |
58 |
cgtgtcgtgtccagtgtccatgtccgtatccatgcttcatag |
99 |
Q |
| |
|
|||||||||||| |||||| ||||||||||| |||||||||| |
|
|
| T |
10577809 |
cgtgtcgtgtccggtgtccgtgtccgtatccgtgcttcatag |
10577850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 34298468 - 34298435
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcg |
34 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
34298468 |
attatgtgattttctcaaattattagtggtgtcg |
34298435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 59 - 96
Target Start/End: Original strand, 40456031 - 40456068
Alignment:
| Q |
59 |
gtgtcgtgtccagtgtccatgtccgtatccatgcttca |
96 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
40456031 |
gtgtcgtgtccggtgtccgtgtccgtatccatgcttca |
40456068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 113331 - 113291
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||| |||||| |
|
|
| T |
113331 |
attatgtgattttttcaaattattagctgtgtcggcgtgtc |
113291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 609485 - 609525
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||| |||||| |
|
|
| T |
609485 |
attatgtaattttctcaaattattagtggtgtcggcgtgtc |
609525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 2896148 - 2896188
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
2896148 |
attatgtgattttctcaaattattagcggtgtcggcgtgtc |
2896188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 63 - 99
Target Start/End: Original strand, 24334774 - 24334810
Alignment:
| Q |
63 |
cgtgtccagtgtccatgtccgtatccatgcttcatag |
99 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
24334774 |
cgtgtccggtgtccgtgtccgtatccatgcttcatag |
24334810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 24577213 - 24577245
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtc |
33 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
24577213 |
attatgtgattttttcaaattattagttgtgtc |
24577245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 32461490 - 32461530
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| ||||||||||||||||| || |||||| |
|
|
| T |
32461490 |
attatgtgattttttcaaattattagttgtgccggcgtgtc |
32461530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 36878493 - 36878453
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
36878493 |
attatgtgattttctcaaattattagcggtgtcggcgtgtc |
36878453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 41
Target Start/End: Complemental strand, 37598860 - 37598824
Alignment:
| Q |
5 |
tgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
37598860 |
tgtgattttttcaaattattagttgtgtcggcgtgtc |
37598824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0053 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0053
Description:
Target: scaffold0053; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 46 - 99
Target Start/End: Complemental strand, 8795 - 8742
Alignment:
| Q |
46 |
cgtgtcaatgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttcatag |
99 |
Q |
| |
|
||||||| ||| |||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
8795 |
cgtgtcagtgtccgtgtcgtgtccggtgtccgtgtccgtatccatgcttcatag |
8742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0306 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: scaffold0306
Description:
Target: scaffold0306; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 13432 - 13392
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13432 |
attatgtgattttctcaaattattagttgtgtcggcgtgtc |
13392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0152 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: scaffold0152
Description:
Target: scaffold0152; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 21895 - 21935
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21895 |
attatgtgattttctcaaattattagttgtgtcggcgtgtc |
21935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 26425 - 26385
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26425 |
attatgtgattttctcaaattattagtggtgtcgacgtgtc |
26385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 48 - 99
Target Start/End: Complemental strand, 130477 - 130426
Alignment:
| Q |
48 |
tgtcaatgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttcatag |
99 |
Q |
| |
|
||||| ||| |||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
130477 |
tgtcattgtccgtgtcgtgtccggtgtccgtgtccgtatccatgcttcatag |
130426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.00000000009; HSPs: 25)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 25096455 - 25096413
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtcgg |
43 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
25096455 |
attatgtgattttctcaaattattagtggtgtcgtcgtgtcgg |
25096413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 141 - 196
Target Start/End: Original strand, 27994378 - 27994435
Alignment:
| Q |
141 |
tgagaactctaataccat--gtgtttctttccttattctctttctctcttctgatact |
196 |
Q |
| |
|
|||||||||| ||| ||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27994378 |
tgagaactctgatatcatccgtgtttctttccttattctctttctctcttatgatact |
27994435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 853886 - 853926
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
853886 |
attatgtgattttttcaaattattagttgtgtcggcgtgtc |
853926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 46 - 98
Target Start/End: Original strand, 10339188 - 10339240
Alignment:
| Q |
46 |
cgtgtcaatgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttcata |
98 |
Q |
| |
|
||||||| ||||| |||||||||| ||||||||||| |||||| ||||||||| |
|
|
| T |
10339188 |
cgtgtcagtgttcatgtcgtgtcctgtgtccatgtctgtatccgtgcttcata |
10339240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 13360399 - 13360439
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
13360399 |
attatgtgattttctcaaattactagtggtgtcgacgtgtc |
13360439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 46 - 98
Target Start/End: Complemental strand, 16766694 - 16766642
Alignment:
| Q |
46 |
cgtgtcaatgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttcata |
98 |
Q |
| |
|
||||||| ||| | |||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
16766694 |
cgtgtcagtgtccatgtcgtgtccggtgtccgtgtccgtatccatgcttcata |
16766642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 34595166 - 34595126
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
34595166 |
attatgtgattttttcaaattattagttgtgtcggcgtgtc |
34595126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 7801183 - 7801222
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgt |
40 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
7801183 |
attatgtgattttttcaaattattagttgtgtcggcgtgt |
7801222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 100
Target Start/End: Original strand, 426576 - 426630
Alignment:
| Q |
46 |
cgtgtcaatgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttcataga |
100 |
Q |
| |
|
||||||| ||| |||||||||||| || ||| |||| |||||||||||||||||| |
|
|
| T |
426576 |
cgtgtcagtgtccgtgtcgtgtccggtatccgtgtctgtatccatgcttcataga |
426630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 7086827 - 7086785
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtcgg |
43 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
7086827 |
attatgtgattttctcaaattattagcagtgccgacgtgtcgg |
7086785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 100
Target Start/End: Original strand, 8777035 - 8777089
Alignment:
| Q |
46 |
cgtgtcaatgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttcataga |
100 |
Q |
| |
|
||||||| ||| |||||||||||| ||||| ||||||||||| ||||||||||| |
|
|
| T |
8777035 |
cgtgtcagtgtccgtgtcgtgtccgttgtccgtgtccgtatccgtgcttcataga |
8777089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 8805599 - 8805641
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtcgg |
43 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
8805599 |
attatgtgattttctcaaattattagcagtgccgacgtgtcgg |
8805641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 3 - 41
Target Start/End: Complemental strand, 16833338 - 16833300
Alignment:
| Q |
3 |
tatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
16833338 |
tatgtgattttttcaaattattagttgtgtcggcgtgtc |
16833300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 100
Target Start/End: Original strand, 34225879 - 34225917
Alignment:
| Q |
62 |
tcgtgtccagtgtccatgtccgtatccatgcttcataga |
100 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
34225879 |
tcgtgtccagtgtccgtgtccgtatccgtgcttcataga |
34225917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 46 - 95
Target Start/End: Original strand, 5732572 - 5732621
Alignment:
| Q |
46 |
cgtgtcaatgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttc |
95 |
Q |
| |
|
||||||| ||| | ||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
5732572 |
cgtgtcagtgtccatgtcgtgtccagtgtccgtgtctgtatccatgcttc |
5732621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 46 - 99
Target Start/End: Complemental strand, 7938113 - 7938060
Alignment:
| Q |
46 |
cgtgtcaatgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttcatag |
99 |
Q |
| |
|
||||||| ||| | |||||||||| |||||| ||||||||||| |||||||||| |
|
|
| T |
7938113 |
cgtgtcagtgtccatgtcgtgtccggtgtccgtgtccgtatccgtgcttcatag |
7938060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 5970135 - 5970175
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
5970135 |
attatgtgattttttcaaattattaactgtgtcgacgtgtc |
5970175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 8365546 - 8365586
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
|||||||||| || |||||||||||||||||||| |||||| |
|
|
| T |
8365546 |
attatgtgatattttcaaattattagttgtgtcggcgtgtc |
8365586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 41
Target Start/End: Original strand, 8777004 - 8777040
Alignment:
| Q |
5 |
tgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
8777004 |
tgtgattttttcaaattattagttgtgtcggcgtgtc |
8777040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 9024203 - 9024243
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||| ||||||||||||||| | ||||||||||||||| |
|
|
| T |
9024203 |
attatgtcattttctcaaattatcatttgtgtcgacgtgtc |
9024243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 10770701 - 10770741
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
10770701 |
attatgtgattttttcaaattattagttgtgttggcgtgtc |
10770741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 17302379 - 17302347
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtc |
33 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
17302379 |
attatgtgattttcttaaattattagttgtgtc |
17302347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 17841616 - 17841656
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||| |||||| |
|
|
| T |
17841616 |
attatgtgattttttcaaattattagctgtgtcggcgtgtc |
17841656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 19040384 - 19040344
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
19040384 |
attatgtgattttctcaaattattagcggtgtcggcgtgtc |
19040344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 19044496 - 19044456
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||| |||||| |
|
|
| T |
19044496 |
attatgtgatattctcaaattattagtcgtgtcggcgtgtc |
19044456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 18)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 46 - 99
Target Start/End: Complemental strand, 15382474 - 15382421
Alignment:
| Q |
46 |
cgtgtcaatgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttcatag |
99 |
Q |
| |
|
||||||| ||| |||||||||||| |||||| ||||||||||| |||||||||| |
|
|
| T |
15382474 |
cgtgtcattgtccgtgtcgtgtccggtgtccgtgtccgtatccgtgcttcatag |
15382421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 110 - 196
Target Start/End: Complemental strand, 36869538 - 36869453
Alignment:
| Q |
110 |
agtactaccccactaaaataaataaattctttgagaactctaataccat--gtgtttctttccttattctctttctctcttctgatact |
196 |
Q |
| |
|
|||| ||| ||||||||| ||||| |||||||||||||| |||||| ||||||||||||||||| ||| |||||||| ||||||| |
|
|
| T |
36869538 |
agtagtactccactaaaaaaaata---tctttgagaactctgataccactcgtgtttctttccttattgtctgtctctcttttgatact |
36869453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 4 - 43
Target Start/End: Original strand, 38464394 - 38464433
Alignment:
| Q |
4 |
atgtgattttctcaaattattagttgtgtcgacgtgtcgg |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
38464394 |
atgtgattttctcaaattattagttgtgtcggcatgtcgg |
38464433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 35017069 - 35017027
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtcgg |
43 |
Q |
| |
|
||||||||||||||||||||||||||| || ||| |||||||| |
|
|
| T |
35017069 |
attatgtgattttctcaaattattagtggtttcggcgtgtcgg |
35017027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 46 - 99
Target Start/End: Original strand, 6326359 - 6326412
Alignment:
| Q |
46 |
cgtgtcaatgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttcatag |
99 |
Q |
| |
|
||||||| ||| |||||||||||| || ||| ||||| |||||||||||||||| |
|
|
| T |
6326359 |
cgtgtcagtgtccgtgtcgtgtccggtatccgtgtccttatccatgcttcatag |
6326412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 19579733 - 19579700
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcg |
34 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
19579733 |
attatgtgattttctcaaattattagctgtgtcg |
19579700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 46 - 99
Target Start/End: Complemental strand, 21522747 - 21522694
Alignment:
| Q |
46 |
cgtgtcaatgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttcatag |
99 |
Q |
| |
|
||||||| ||| |||||||||||| ||| || ||||||||||| |||||||||| |
|
|
| T |
21522747 |
cgtgtcagtgtccgtgtcgtgtccggtgaccgtgtccgtatccgtgcttcatag |
21522694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 46 - 99
Target Start/End: Complemental strand, 21533313 - 21533260
Alignment:
| Q |
46 |
cgtgtcaatgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttcatag |
99 |
Q |
| |
|
||||||| ||| |||||||||||| ||| || ||||||||||| |||||||||| |
|
|
| T |
21533313 |
cgtgtcagtgtccgtgtcgtgtccggtgaccgtgtccgtatccgtgcttcatag |
21533260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 46 - 99
Target Start/End: Original strand, 36642824 - 36642876
Alignment:
| Q |
46 |
cgtgtcaatgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttcatag |
99 |
Q |
| |
|
||||||| ||| |||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
36642824 |
cgtgtcagtgtccgtgtcgtgtccggtgtct-tgtccgtatccatgcttcatag |
36642876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 6247654 - 6247614
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||| |||||| |
|
|
| T |
6247654 |
attatgtgattttttcaaattattagatgtgtcggcgtgtc |
6247614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 6770575 - 6770543
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtc |
33 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
6770575 |
attatgtgattttcttaaattattagttgtgtc |
6770543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 14674301 - 14674261
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||| |||||| |
|
|
| T |
14674301 |
attatgtgattttttcaaattattagctgtgtcggcgtgtc |
14674261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 22423839 - 22423871
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtc |
33 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
22423839 |
attatgtgattttctcaaattattagtagtgtc |
22423871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 31084355 - 31084315
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||| |||||| |
|
|
| T |
31084355 |
attatgtgattttttcaaattattagctgtgtcggcgtgtc |
31084315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 33178057 - 33178017
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| | |||||||||||||||||| |||||| |
|
|
| T |
33178057 |
attatgtgatttttttaaattattagttgtgtcggcgtgtc |
33178017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 99
Target Start/End: Complemental strand, 34276853 - 34276801
Alignment:
| Q |
47 |
gtgtcaatgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttcatag |
99 |
Q |
| |
|
|||||||||| ||||||||||| || ||| ||||||||||| |||||||||| |
|
|
| T |
34276853 |
gtgtcaatgtctgtgtcgtgtccggtatccgtgtccgtatccgtgcttcatag |
34276801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 39205912 - 39205872
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
39205912 |
attatatgattttctcaaattattagcagtgtcgacgtgtc |
39205872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 41995503 - 41995463
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| |||||| |
|
|
| T |
41995503 |
attatgtgattttttcgaattattagttgtgtcggcgtgtc |
41995463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 22)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 750645 - 750734
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtcgggacgtgtcaatgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttcatag |
99 |
Q |
| |
|
|||||||||| || |||||||||||||||||||| |||||| | ||||| |||||||||||| |||||| ||||||||||| |||||||||| |
|
|
| T |
750645 |
attatgtgatattttcaaattattagttgtgtcgccgtgtc---aagtgtc------cgtgtcgtgtccggtgtccgtgtccgtatccgtgcttcatag |
750734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 34910349 - 34910308
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtcg |
42 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
34910349 |
attatgtgattttttcaaattattagttgtgtcggcgtgtcg |
34910308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 10954984 - 10954944
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
10954984 |
attatgtgattttttcaaattattagttgtgtcggcgtgtc |
10954944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 11493388 - 11493428
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
11493388 |
attatgtgattttctcacattattagtggtgtcgacgtgtc |
11493428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 59 - 99
Target Start/End: Complemental strand, 21479108 - 21479068
Alignment:
| Q |
59 |
gtgtcgtgtccagtgtccatgtccgtatccatgcttcatag |
99 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
21479108 |
gtgtcgtgtccggtgtccgtgtccgtatccatgcttcatag |
21479068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 60 - 99
Target Start/End: Original strand, 35994813 - 35994852
Alignment:
| Q |
60 |
tgtcgtgtccagtgtccatgtccgtatccatgcttcatag |
99 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
35994813 |
tgtcgtgtccggtgtccatgtccgtatccgtgcttcatag |
35994852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 3164052 - 3164090
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtg |
39 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
3164052 |
attatgtgattttttcaaattattagctgtgtcgacgtg |
3164090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 84
Target Start/End: Complemental strand, 8383254 - 8383216
Alignment:
| Q |
46 |
cgtgtcaatgttcgtgtcgtgtccagtgtccatgtccgt |
84 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
8383254 |
cgtgtcaatgtccgtgtcgtgtccagtgtccgtgtccgt |
8383216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 100
Target Start/End: Original strand, 10335348 - 10335402
Alignment:
| Q |
46 |
cgtgtcaatgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttcataga |
100 |
Q |
| |
|
||||||| ||| |||||||||||| |||||| ||| ||||||| ||||||||||| |
|
|
| T |
10335348 |
cgtgtcagtgtccgtgtcgtgtccggtgtccgtgttcgtatccgtgcttcataga |
10335402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 8412972 - 8413005
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcg |
34 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
8412972 |
attatgtgtttttctcaaattattagttgtgtcg |
8413005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 58 - 99
Target Start/End: Complemental strand, 14028000 - 14027959
Alignment:
| Q |
58 |
cgtgtcgtgtccagtgtccatgtccgtatccatgcttcatag |
99 |
Q |
| |
|
|||||||||||| |||||| ||||||||||| |||||||||| |
|
|
| T |
14028000 |
cgtgtcgtgtccggtgtccgtgtccgtatccgtgcttcatag |
14027959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 14209145 - 14209104
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtcg |
42 |
Q |
| |
|
||||||||||||| | |||||||||||||||||| ||||||| |
|
|
| T |
14209145 |
attatgtgattttttaaaattattagttgtgtcggcgtgtcg |
14209104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 46 - 99
Target Start/End: Original strand, 15796356 - 15796409
Alignment:
| Q |
46 |
cgtgtcaatgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttcatag |
99 |
Q |
| |
|
||||||| ||| |||||||||||| |||||| ||||| ||||| |||||||||| |
|
|
| T |
15796356 |
cgtgtcattgtccgtgtcgtgtccggtgtccgtgtccatatccgtgcttcatag |
15796409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 24633798 - 24633765
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcg |
34 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
24633798 |
attatgtgattttctcaaattattagtggtgtcg |
24633765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 28812547 - 28812506
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtcg |
42 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
28812547 |
attatgtgatttcttcaaattattagttgtgtcggcgtgtcg |
28812506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 55401107 - 55401074
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcg |
34 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
55401107 |
attatgtgattttttcaaattattagttgtgtcg |
55401074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 2620080 - 2620120
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||| |||||| |
|
|
| T |
2620080 |
attatgtgattttctcaaatgattagtggtgtcggcgtgtc |
2620120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 44 - 100
Target Start/End: Original strand, 3164085 - 3164141
Alignment:
| Q |
44 |
gacgtgtcaatgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttcataga |
100 |
Q |
| |
|
|||||| || ||| |||||||||||| |||||| |||| |||||| ||||||||||| |
|
|
| T |
3164085 |
gacgtgccattgtccgtgtcgtgtccggtgtccgtgtctgtatccgtgcttcataga |
3164141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 4987318 - 4987358
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||| |||||| |
|
|
| T |
4987318 |
attatgtgattttttcaaattattagctgtgtcggcgtgtc |
4987358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 12704039 - 12703999
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||| |||||| |
|
|
| T |
12704039 |
attatgtgcttttctcaaattattagtggtgtcggcgtgtc |
12703999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 40052364 - 40052324
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||| |||||| |
|
|
| T |
40052364 |
attatgtgattttttcaaattattagctgtgtcggcgtgtc |
40052324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 46191372 - 46191412
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||| ||||| |
|
|
| T |
46191372 |
attatgtgattttctcaaattattattggtgtcgatgtgtc |
46191412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0361 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0361
Description:
Target: scaffold0361; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 14562 - 14522
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
14562 |
attatgtgattttttcaaattattagttgtgtcggcgtgtc |
14522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 20)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 99
Target Start/End: Complemental strand, 9778504 - 9778452
Alignment:
| Q |
47 |
gtgtcaatgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttcatag |
99 |
Q |
| |
|
|||||| ||| |||||||||||| |||||| ||||||||||| |||||||||| |
|
|
| T |
9778504 |
gtgtcagtgtccgtgtcgtgtccggtgtccgtgtccgtatccgtgcttcatag |
9778452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 40
Target Start/End: Complemental strand, 28401172 - 28401136
Alignment:
| Q |
4 |
atgtgattttctcaaattattagttgtgtcgacgtgt |
40 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28401172 |
atgtgattttctcaaattattagtagtgtcgacgtgt |
28401136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 35861996 - 35861903
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtcgggacgtgtcaatgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttcata |
98 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||| |||| | ||| ||||||||||| |||||| |||||||||| ||||||||| |
|
|
| T |
35861996 |
attatgtgattttttcaaattattagttgtgtcggcgtgt----tagtgttagtgtctgtgtcgtgtccggtgtccgcgtccgtatccgtgcttcata |
35861903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 195
Target Start/End: Complemental strand, 36903219 - 36903183
Alignment:
| Q |
159 |
gtgtttctttccttattctctttctctcttctgatac |
195 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36903219 |
gtgtttctttcgttattctctttctctcttctgatac |
36903183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 21141009 - 21141051
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtcgg |
43 |
Q |
| |
|
||||| ||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
21141009 |
attatatgattttcttaaattattagtggtgtcgacgtgtcgg |
21141051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 46 - 99
Target Start/End: Complemental strand, 1433451 - 1433398
Alignment:
| Q |
46 |
cgtgtcaatgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttcatag |
99 |
Q |
| |
|
||||||||||| |||||||||| | |||||| || |||||||| |||||||||| |
|
|
| T |
1433451 |
cgtgtcaatgtccgtgtcgtgttcggtgtccgtgcccgtatccgtgcttcatag |
1433398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 3991356 - 3991323
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcg |
34 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
3991356 |
attatgtgattttttcaaattattagttgtgtcg |
3991323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 11831464 - 11831423
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtcg |
42 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
11831464 |
attatatgattttttcaaattattagttgtgtcgatgtgtcg |
11831423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 46 - 107
Target Start/End: Original strand, 26329444 - 26329505
Alignment:
| Q |
46 |
cgtgtcaatgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttcatagagtactac |
107 |
Q |
| |
|
||||||| ||| |||||||||||||||||| |||| |||| | |||||||||| ||||||| |
|
|
| T |
26329444 |
cgtgtcagtgtctgtgtcgtgtccagtgtccgtgtctgtattcgtgcttcatagggtactac |
26329505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 5307292 - 5307252
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||| |||||| |
|
|
| T |
5307292 |
attatgtgattttctcaaattataagtggtgtcggcgtgtc |
5307252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 11665467 - 11665499
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtc |
33 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
11665467 |
attatgtgattttttcaaattattagttgtgtc |
11665499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 22868074 - 22868034
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||| |||||| |
|
|
| T |
22868074 |
attatgtgattttctcatattattagtggtgtcggcgtgtc |
22868034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 23746942 - 23746910
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtc |
33 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
23746942 |
attatgtgattttctcaaattataagttgtgtc |
23746910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 24339674 - 24339634
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||| |||||| |
|
|
| T |
24339674 |
attatgtgattttttcaaattattagctgtgtcggcgtgtc |
24339634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 25481934 - 25481894
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||| |||||| |
|
|
| T |
25481934 |
attatgtgattttttcaaattattagctgtgtcggcgtgtc |
25481894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 26733336 - 26733296
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
26733336 |
attatgtgattttgtcaaattattagcggtgtcgacgtgtc |
26733296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 27945073 - 27945033
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||| |||||| |
|
|
| T |
27945073 |
attatgtaattttctcaaattattagtggtgtcggcgtgtc |
27945033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 32308152 - 32308112
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
32308152 |
attatgtgattttctcaaattattagcggtgtcggcgtgtc |
32308112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 100 - 132
Target Start/End: Complemental strand, 36903615 - 36903583
Alignment:
| Q |
100 |
agtactactaagtactaccccactaaaataaat |
132 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
36903615 |
agtactactaagtactaccctactaaaataaat |
36903583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 41020528 - 41020488
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41020528 |
attatgtgatttttgtaaattattagttgtgtcgacgtgtc |
41020488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 10)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 58 - 100
Target Start/End: Original strand, 1572363 - 1572405
Alignment:
| Q |
58 |
cgtgtcgtgtccagtgtccatgtccgtatccatgcttcataga |
100 |
Q |
| |
|
||||||||||||||||| ||||||| ||| ||||||||||||| |
|
|
| T |
1572363 |
cgtgtcgtgtccagtgttcatgtccatattcatgcttcataga |
1572405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 100 - 137
Target Start/End: Complemental strand, 37622641 - 37622604
Alignment:
| Q |
100 |
agtactactaagtactaccccactaaaataaataaatt |
137 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
37622641 |
agtactactaagtactaccccactaaaaaaaacaaatt |
37622604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 11670787 - 11670747
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| ||||||||||||| | ||||||||||| |
|
|
| T |
11670787 |
attatgtgattttttcaaattattagtggcgtcgacgtgtc |
11670747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 12940962 - 12941002
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
12940962 |
attatatgattttttcaaattattagttgtgtcaacgtgtc |
12941002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 20539701 - 20539741
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||| ||||||| |||||||||||| |||||||||||||| |
|
|
| T |
20539701 |
attatatgattttttcaaattattagctgtgtcgacgtgtc |
20539741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 21616794 - 21616754
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
21616794 |
attatgtgattttctcaaattattagcggtgtcggcgtgtc |
21616754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 21782845 - 21782885
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
21782845 |
attatgtgattttctcaaattattagcagtgtcggcgtgtc |
21782885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 59 - 99
Target Start/End: Complemental strand, 26769501 - 26769461
Alignment:
| Q |
59 |
gtgtcgtgtccagtgtccatgtccgtatccatgcttcatag |
99 |
Q |
| |
|
||||||||||| |||||| ||||||||||| |||||||||| |
|
|
| T |
26769501 |
gtgtcgtgtccggtgtccgtgtccgtatccgtgcttcatag |
26769461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 9 - 41
Target Start/End: Complemental strand, 33498652 - 33498620
Alignment:
| Q |
9 |
attttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
33498652 |
attttctcaaattattacttgtgtcgacgtgtc |
33498620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 36756371 - 36756411
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
36756371 |
attatgttatttcttcaaattattagttgtgtcgacgtgtc |
36756411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0027 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 46 - 99
Target Start/End: Complemental strand, 46679 - 46626
Alignment:
| Q |
46 |
cgtgtcaatgttcgtgtcgtgtccagtgtccatgtccgtatccatgcttcatag |
99 |
Q |
| |
|
||||||| ||| |||||||||||| ||||| ||||||||||| |||||||||| |
|
|
| T |
46679 |
cgtgtcattgtccgtgtcgtgtccgatgtccgtgtccgtatccgtgcttcatag |
46626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0223 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 20204 - 20164
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||| |||||| |
|
|
| T |
20204 |
attatgtgattttttcaaattattagctgtgtcggcgtgtc |
20164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0122
Description:
Target: scaffold0122; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 8042 - 8002
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||| |||||| |
|
|
| T |
8042 |
attatatgattttttcaaattattagttgtgtcggcgtgtc |
8002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0103 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0103
Description:
Target: scaffold0103; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 51843 - 51803
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtcgacgtgtc |
41 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||| |||||| |
|
|
| T |
51843 |
attatgtgattttttcaaattattagctgtgtcggcgtgtc |
51803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 17776 - 17808
Alignment:
| Q |
1 |
attatgtgattttctcaaattattagttgtgtc |
33 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
17776 |
attatgtgattttttcaaattattagttgtgtc |
17808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University