View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16701_high_40 (Length: 227)
Name: NF16701_high_40
Description: NF16701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16701_high_40 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 9 - 227
Target Start/End: Original strand, 2587957 - 2588175
Alignment:
| Q |
9 |
gtctatggagtagtacctgacaatggcaaaccattgattggttgttcggaaaatctacgcggctggtggaaagaccaagtaaactttgagaaaaacggtc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2587957 |
gtctatggagtagtacctgacaatggcaaaccattgattggttgttcggaaaatctacgcggctggtggaaagaccaagtaaactttgagaaaaacggtc |
2588056 |
T |
 |
| Q |
109 |
tagctgcaatcgctagatatcaagaagaacgtggagtttcaacaatgaatggcatgttgcttgatgagcaagtaaagccttattccttgtatgatctacc |
208 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2588057 |
tagctgcaatcgctaaatatgaagaagaacgtggagtttcaacaatgaatggcatgttgcttgatgagcaagtaaagccttactccttgtatgatctacc |
2588156 |
T |
 |
| Q |
209 |
tgatacaatattaggttca |
227 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
2588157 |
tgatacaatattaggttca |
2588175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University