View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16701_low_12 (Length: 384)
Name: NF16701_low_12
Description: NF16701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16701_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 103 - 356
Target Start/End: Original strand, 37528949 - 37529202
Alignment:
| Q |
103 |
ggttatttgactgtataatagtactatactatagtattttagattagaattaannnnnnngcataaataaaagttatatagattagattaggattagata |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37528949 |
ggttatttgactgtataatagtactatactatagtattttagattagatttaatttttttgcataaataaaagttatatagattagattaggattagata |
37529048 |
T |
|
| Q |
203 |
tataggagtgcagtatcccgcgggatacacggggggaaaatttctgttgtgtaaatccttaactttgaaggcccactgacccacctcactacactacact |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37529049 |
tataggagtgcagtatcccgcgggatacacggggggaaattttctgttgtgtaaatccttaactttgaaggcccactgacccacctcactacactacact |
37529148 |
T |
|
| Q |
303 |
cctcttaaaatccttcgtaccacgtttctgtatcacacaccagttctgtgcctg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37529149 |
cctcttaaaatccttcgtaccacgtttctgtatcacacaccagttctgtgcctg |
37529202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University